Q: List five proteins of the myofilaments and describe their physical arrangement.
A: The myofilaments are the proteins that make up the contractile elements of muscle cells. There are…
Q: ¹C2²2S + E Sk3,0 where S is a T-cell of a particular variety, E is the corresponding (free, i.e.…
A: T cell, also called T lymphocyte, type of leukocyte (white blood cell) that is an essential part of…
Q: The Purkinje cell is an example of this type of neuron. sensory neuron pyramidal neuron principal…
A: Purkinje cell or purkinje neuron is large, branched and unique type of neuron located in the…
Q: DDT-Curse or Blessing? The general public first became acutely aware of the impact of human activity…
A: DDT, which is the abbreviation of dichlorodiphenyltrichloroethane, is an insecticide that is added…
Q: 15. Most proteins that pass through the filtration barrier are absorbed at which of the following…
A: Kidney are the bean shaped red colour organs located at retroperitoneal space which helps in removal…
Q: In the figure below, the coding sequence for gene F is read from left to right, and the coding…
A: The template strand is the strand that provides the template sequences for the synthesis of a new…
Q: Extracellular recordings create a distinct action potential. Choose the option that best describes…
A: INTRODUCTION : Extracellular recordings - These are recordings of electrical potentials which are…
Q: Question 6 A group of environmental scientists wants to make a plan that will reduce human impacts…
A: In the lower atmosphere, CO2, methane, N2O, and CFCs are the major greenhouse gases those levels are…
Q: A 44-year-old female with a 15-year history of Type 2 diabetes presents to urgent care with an ulcer…
A: Macrophages are specialised cells involved in the detection, phagocytosis and destruction of…
Q: Would water molecules move faster when there is a high concentartion gradient or low concentartion…
A: Introduction The net movement of anything, typically from a place of higher concentration to a…
Q: explain how you would control for interference in a protein assay?.
A: Ans: Protein assays are considered to be widely used in the life science research to determine the…
Q: Ribosomal prote 4. Eukaryotic ribosomes have some similarities to prokaryotic ribosomes, but they…
A: Prokaryotic cell do not have membrane bound organelles however eukaryotic cells do have. Prokaryotic…
Q: n the F2 generation, 306 rabbits with red eyes and 71 with a white eye phenotype suppose the…
A: Important principles in the study of genetics are represented by the names F1 and F2 generations.…
Q: What type of molecule is BSA? Briefly describe BSA's role/function
A: Blood plasma is a straw coloured, viscous fluid which occupies 55% of the total blood volume. It…
Q: Name the five types of white blood cells, and state a function for each type.?
A: We know that Cells are the basic structural and functional unit of all known organisms and are…
Q: Given our understanding of modern human genetic variation, why is the concept of race a biological…
A: Genes are the basic unit of biological inheritance which is passed down from one generation to the…
Q: Why is it important to perform both quality control and assurance in a cytogenetic laboratory? Does…
A: Cytogenetics is the study of chromosome alterations, such as damaged, absent, altered, or…
Q: 1. A homozygous dominant yellow gumamela (YY) is crossed with a homozygous dominant red gumamela…
A: Please note, in keeping with the site regulations, and in order to provide a good-quality answer,…
Q: SC5 X + core.learn.edgenuity.com/player/ ence- SC5181 A n 21 22 size h A scientist studying an…
A: Aquatic ecosystems include both saltwater and freshwater biomes. The abiotic factors important for…
Q: what are the consequences of pericarditis?
A: The pericardium is the layer(s) surrounding the heart that is made up of connective tissues and it…
Q: State at least four functions of the kidneys other than forming urine.
A: Kidneys are paired, reddish- brown, bean shaped organs that are found in human beings. Human kidneys…
Q: Let's say that the cross-sectional area of the aorta is 1 cm2 = 100 mm2. The blood pumps through the…
A: The circulatory system in humans is responsible for the distribution of oxygenated blood throughout…
Q: The structure of a biological macromolecule is shown below. Match the information describing this…
A: Macromolecule name is protein Monomer subunit is peptide R symbolizes in macro molecule is side…
Q: What is the Importance of butterflies within an ecosystem and to humans? How do humans negatively…
A: The structural and functional unit of ecology known as the ecosystem is where living things interact…
Q: Why most you use deionized water rather than tap water in this experiment? A- Tap water has many…
A: Introduction : Distilled water is known as deionized water. It is purified water from which all the…
Q: Glucose 2 ATP k. a. h. 2 ADP 2 PGAL electron transport r. +2e + 0₂ d. 2 NAD + b. 4 ADP C. 2 NAD + f.…
A:
Q: The ions that most contribute to the voltage properties of the neuronal membrane are: chloride,…
A:
Q: Explain how conservation genetics is used to understand problems faced by speciessuch as the Florida…
A: Conservation Genetics is the application of genetics to preserve species as dynamic entities capable…
Q: Name the five types of white blood cells, and state a function for each type
A: Introduction A component of the immune system that guards against infection is the white blood cell.…
Q: 3. Discuss the advantage and disadvantage of Wijs method of iodine value determination. What…
A: A method for determining the iodine number (as of an oil or fat) that consists in adding a solution…
Q: 1. Jiro is performing an experiment on photosynthesis using Hydrilla plants. He wants to know which…
A: The Hydrilla is water or aquatic plant. These plants lack stomata and due to these unique…
Q: Describe the difference between the distal end of a humerus and the distal end of a femur
A: The femur is the body’s largest & longest bone. It is also called as a thighbone. This bone is…
Q: Cell membranes are not permeable to anthocyanin. If the anthocyanin appears in the solution, what…
A: It is true that cell membranes are not permeable to anthocyanin. Anthocyanin is the pigment…
Q: Antipronation shoes are specialized shoes to keep the feet from pronating . Does this mean that by…
A: Pronation means natural movement of foot while walking or running. Antipronation shoes are used by…
Q: A flower that possesses a single pistil, 1 stamen, no petals, and no sepals: (choose all that apply)…
A:
Q: Gene dosage is important for a number of genetic phenomenon. Name two and explain their relationship…
A: The gene dosage is a concept in which the synthesis and concentration of the primary gene product is…
Q: What happens to Vital Capacity of someone with emphysema? a. Vital capacity stays the same, because…
A: The volume of air expired by the lungs after forceful inspiration and expiration is called vital…
Q: D In the following DNA strand, find the position of the start codon, stop codon and determine the…
A: The given DNA strand - GGTACTTTATACCCTGATACATTTGTGGGG Corresponding mRNA strand -…
Q: explain mutualism, parasitism, and commensalism
A: Symbiotic relationships are close relationships between two or more organisms of different species.…
Q: The AG of the reaction C6H12O6 + 60₂ --> 6CO₂ + 6H₂O is -686 kcal/mol glucose oxidized. The AG of…
A: In order to understand the reaction, a few basic definitions are provided below - δG refers to Gibbs…
Q: Instructions Explain 1 way each of the following can occur. In your answer, say whether non-…
A: Nondisjunction:- The event during cell division in which chromosomes do not separate properly. This…
Q: What is the purpose of studying "Equality in the Sexes in Human Evolution"?
A: Evolution is the study where changes in populations and communities are observed over many…
Q: Which BEST describes how survival of the fittest relates to natural selection? A) Organisms with…
A: Introduction Charles Darwin proposed the theory of evolution by natural selection, which states that…
Q: List all cellular organelles and describe their functions
A: Introduction In biology, a cell is a basic membrane-bound entity that houses the building blocks of…
Q: Hand bones are generally smaller and thinner than foot bones. Other than robusticity of the bones,…
A: The foot forms a firm basis of support for the body in the erect posture, and is therefore more…
Q: Physical or biological anthropologists typically
A: Anthropology also called as science of humanity is the study of origin and development of human…
Q: How can transposons contribute to specific human diseases?.
A: Introduction Genetics is a branch of science that deals with the study of genes, heredity, and…
Q: D In fava bean plant the seed color can be coded by two alleles, green (G) which is dominant and…
A: True breeding plants are those that have homozygous alleles (which means two copies of a single…
Q: The following describes the arrangement of the phospholipid heads within the cell membrane: Oa. One…
A: Singer and Nicolson in 1972, described the phospholipid bi-layered structure of a cell i.e., the…
Q: 14 15 16 17 18 19 Which of the following examples could help reduce competition between two species?…
A: Competitive exclusion can easily be avoided if one or both of the species that are competing-…
Step by step
Solved in 2 steps
- The principal force driving movement in diffusion is______. a. temperature b. particle size c. concentration gradient d. membrane surface areaWater moves via osmosis _______. a. throughout the cytoplasm b. from an area with a high concentration of other solutes to a lower one c. from an area with a low concentration of solutes to an area with a higher one d. from an area with a low concentration of water to one of higher concentrationWater travels from a region of hypotonic fluid to a region of hypertonic fluid across a selectively permeable cell membrane during the following O a Diffusion Ob Osmosis Oc Endocytosis Od A and B Oe. All of the Above
- Which of the following is a way for electrolytes in an aqueous solution to move from an area of high solute concentration to an area of low concentration? O a. Active transport O b. Osmosis O c. Simple diffusion Od. Facilitated diffusion O e. None of theseWhich of the following statement(s) about passive processes of membrane transport is false? a. cellular energy is not requiredb. substances move along its concentration gradientc. all require the aid of proteins during transportd. all of the abovee. none of the aboveThe passive non-mediated movement of particles across a membrane driven by pressure is A. filtration B. diffusion C. facilitated diffusion D. osmosis E. active transport F. vesicular transport
- Which of the following statement(s) about active processes of membrane transport is false? a. cellular energy is requiredb. substances move against its concentration gradientc. all requires the aid of proteins during transportd. occurs in all cell membranese. none of the aboveDefine the following terms:a. osmosisb. osmotic pressurec. isotonic solutiond. membrane potentiale. hydronium ionWhich of the following processes couldoccur only in the plasma membrane of aliving cell?a. facilitated diffusionb. simple diffusionc. filtrationd. active transporte. osmosis
- Active transport of a substance across a membrane requiresa. a gradient b. the expenditure of ATP c. water d. diffusionWhich of those ions do not have specific pumps in membrane? Select one: a. K O b. H O c. CI d. NaIn considering the diffusion of ions through an ion channel, which driving force/forces must be considered?a. the ion concentration gradientb. the electrical gradientc. osmosisd. facilitated diffusione. both a and b