Q: If gene transcription is inhibited after fertilization, development past the two-cell stage does not…
A: The difference lies in the distinct developmental processes: gene transcription inhibition halts…
Q: LO21 Calculate genotypes and phenotypes in sex-linked, sex-limited and sex- influenced traits The…
A: The presence of beard on some goat is determined by autosomal gene and it is dominant in males and…
Q: 4. What is ATP? 5. Diagram the ATP Cycle and label all of the parts. 6. What is an enzyme? 7. Define…
A: ATP, or adenosine triphosphate, is a crucial molecule found in all living cells. It serves as the…
Q: 1750 bacterial cells in a medium are growing exponentially. Calculate the initial instantaneous…
A: instantaneous growth rate represents exponential growth. Exponential growth is continuous growth of…
Q: Salacylic acid can be used to Select one: O a. decrease fever, increase O b. prevent ulcers,…
A: Salicylic acid is a type of medication that is commonly used to treat skin conditions such as acne…
Q: Which of the following primate groups is most closely related to humans? 0000 Monkeys Great apes…
A: Evolution is the change in the frequency of traits in a population over time. Adaptions of organisms…
Q: What is this formula and how is it derived?? This was used in an experiment related to the screening…
A: Various analytical techniques are used to examine the amounts of carotenoids in biological…
Q: When would you use a compound light microscope instead of a dissecting microscope?
A: A microscope is an instrument that is used to obtain an enlarged image of a tiny objects, showing…
Q: genetic disease: 25% 100% 50% XAY 0% ХА Y ХА ХАХА XAY ХАХА What is the probability that these two…
A: Punnett square is a chart which helps in determining the percentage of different genotypes in…
Q: Section 23.1 23.6 Identify the reaction (s) of the Citric cycle that involve(s) a. reduction of FAD…
A: "Since you have posted multiple questions with multiple sub parts, we will provide the solution only…
Q: Ms. Michi is a researcher in a renowned pharmaceutical company based in Singapore. One of the cell…
A: In the field of pharmaceutical research, maintaining contamination-free cell lines and accurately…
Q: Create a dichotomous key using the genera/species: Mycale laxissima, Halichondria poa, Amphimedon…
A: A dichotomous key based on the provided genera/species and their characteristics:Growth form:…
Q: Part A Drag the labels onto the diagram to identify structural features associated with the plasma…
A: A critical part of cells, the plasma membrane is fundamental for maintaining cellular action and…
Q: Question 5 Use the following diagram to answer questions 4 and 5: Chose the appropriate letter. 14N…
A: Production of new DNA from the old DNA is known as DNA replication. In case of eukaryotic cells DNA…
Q: 1- How would you describe the Lenski experiment and its significance? Could you provide a concise…
A: Richard Lenski and his team did the Lenski experiment, in which they observed and study the process…
Q: How would you prepare a 1:500 dilution? You cannot use more than 10mL per tube.
A: In scientific research and experimentation, it is often necessary to dilute substances to achieve…
Q: Calcium storing membranous network in muscle fibers Transmit the action potential to the interior of…
A: The motor neuron's axon receives an action potential.On the axon, the action potential opens…
Q: A. Describe in complete sentences how the requirement of a PAM sequence affects the flexibility of…
A: To make specific changes in organism's DNA scientific found a method, this method is known as gene…
Q: Explain ; Chemoreceptors Stretch receptors Thermoreceptors
A: Sensory receptors are trained to recognise specific types of stimuli. They transform the stimulus…
Q: Match the property with the amino acid. Glutamic Acid Glutamate ✓ [Choose ] Proton Withdrawing…
A: The question pertains to matching a property with the amino acid glutamic acid or glutamate.…
Q: What are different methods used to render cells competent?
A: Cell is the basic biological unit of life. Each organisms are made up of cell.Competent cells are…
Q: Based only the information given, can you classify this outbreak as an endemic to South Africa? Why…
A: Measels is a viral infection to which small children are easily prone. The outbreak can be prevented…
Q: Swim bladders in fish and lungs in terrestrial animals have a common evolutionary origin, but have…
A: Swim bladders in fish and lungs in terrestrial animals have a common evolutionary origin,…
Q: Explain the scheme. b) How can we turn the balance to opposite way?
A: Oxidative stress is defined as a condition of imbalance between the Reactive Oxygen species or the…
Q: 28. Approximately 50 % of the human genome is composed of a. protein-coding genes b. ribosomal…
A: The human genome is a complex entity composed of various components. One of the options provided…
Q: Calculate the value of colour index of the examined blood if the amount of hemoglobin makes 140g/l,…
A: Red blood cells are responsible for the transport of oxygen to all the cells in the body. It is the…
Q: In the absence of lactose and the presence of glucose the lac operon is strongly expressed . Lacl is…
A: Introduction:-Lactose metabolism genes are found in the lac operon of E. coli. It is only expressed…
Q: excitatory and 15 inhibitory postsynaptic potentials appear simultaneously on the plasmatic membrane…
A: EPSP is the excitatory postsynaptic potential. This is the graded potential whose function is to…
Q: Which restriction enzyme is best suited for cloning in pUC8?
A: The restriction enzymes are specific endonuclease that cut the double stranded DNA from the middle…
Q: Which of the following statements is true? Multiple Choice The human body normally uses very…
A: The physical framework that comprises the numerous systems and chemicals that constitute a human…
Q: Part A Drag the labels onto the diagram to identify the structural elements of a DNA molecule.…
A: DNA or deoxyribonucleic acid is the genetic material in living organisms that is composed of two…
Q: A naked (non-enveloped) virus ONLY has a/an O nucleocapsid O envelope O antigenic surface O caporite…
A: The viruses are classified as both living as well as non-living. When they are present outside of…
Q: Answer true or false for each of the following statements: a. Inbreeding tends to reduce the ability…
A: The following statements require a true or false response, and each statement has its own context…
Q: 24. Only 30% of adult humans can hydrolyze lactose. Unlike their lactose-intolerant fellow humans,…
A: The ability to digest lactose, the sugar found in milk, varies among adult humans. Approximately 30%…
Q: How does dilution affect the concentration of enzymes and their catalytic activity in a biological…
A: Dilution refers to the process of reducing the concentration of a solute in a solution by adding…
Q: A. How many ATP's could theoretically be produced when a granule of glycogen is hydrolyzed to…
A: Glycogen is the storage form of glucose in the body localized in the liver. Glycogen is a highly…
Q: What is biology
A: Science is defined as any defined knowledge system that deals with the physical world and its…
Q: How viruses are inhibited by interferons
A: VirusesThese are microscopic infectious agents that infect living organisms. They depend on the…
Q: Viruses cannot be grown in standard microbiological culture such as broth and agar. They need to be…
A: Cytopathic effectsIt is defined as the morphological changes produced by the virus in the cell line…
Q: ASAP PLEASE In Talons, the feral style (S) is dominant over the gladiator style (s), and green eyes…
A: Genetics is defined as the study of heredity that is how characters are transferred from parents to…
Q: Select one microorganism (a prokaryote, protest, or fungus) which has the potential to be used for…
A: as per our company guidelines we are supposed to answer only 1 question. Kindly repost other parts…
Q: What is the molecular weight of the three proteins used as calibration standards: RNAase, BSA and…
A: In scientific research and laboratory experiments, calibration standards are essential for accurate…
Q: Among the tetrapods, reptiles evolved a key adaptation that allowed them to become fully independent…
A: Evolution is the process of change over time in the inherited characteristics of a population of…
Q: Fill in the gaps in the paragraphs below: Blood pressure can be regulated by the nervous system, in…
A: The two parts of the autonomic nervous system are- sympathetic and parasympathetic. The sympathetic…
Q: 1. Paramecium caudatum is a unicellular organism that can phagocytose and digest a bacterium using…
A: Within the unicellular living being Paramecium caudatum, hydrolytic enzymes are utilized during the…
Q: An organ system includes a minimum of how many organs with similar primary functions?
A: An organ system is a group of organs that work together to perform specific functions within an…
Q: For questions 4 - 7; fill in the blank to complete each sentence or statement. in order to begin…
A: Green plants make their own food by photosynthesis. Photo refers to 'sunlight'. Synthesis refers 'to…
Q: It’s late summer and a new influenza virus strain has appeared in chickens across the country. It’s…
A: I would analyze the genetic sequence of the new strain and compare it to the key mutations…
Q: Are there any other organisms that protect the body? If so, what is it and how does it work?
A: Organisms are specific individual that are living thing i.e. they carryout life activities. That can…
Q: True or False: The traits of individuals who produce more surviving offspring spread through the…
A: Traits are observable characteristics or attributes of an organism that can be inherited and passed…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 3 steps
- Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table for reference. 5' AGUCCGUAC 3' 5' AAUUGCUUC 3'For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid
- Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the polypeptide chain based from the given codons of MRNA (3' AAU GCC AGU GGU 5')? * U UUU Phe UCU) UC UCA UCG UAU] UAC Tyr UAA Stop UGA Stop A UAG Stop UGG Trp G UGU U UUC) UGC Cys Ser UUA Leu UUGJ CU) CCU CAU1 CGU His CUC CAC CAA CGC CC Leu CCA Pro Arg CUA CGA A Gin CUG) CG CAG CGG G AUU) ACU) AGU AAU1 Asn AAC, Thr AAA1 U AGC }Ser č A G AUC lle ACC A AUA J ACA AGA AUG Met ACG, AAG}Lys AGG Arg GGU GUU) GUC Val GCU) GCC GCA GCG J GAU1 Asp GACI Ala GGC GGA GGG ) G GUA Gly GAA1 GAG) A Glu GUG) G Figure 1.3 Alanine, Serine, Glycine, Asparagine Serine, Glycine, Asparagine, Alanine Glycine, Asparagine, Alanine, Serine Asparagine, Alanine, Serine, GlycineWrite the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC GCG CGG UAA-3'Refer to the information on the genetic code. Use this information to determine how many amino acids are coded for by the mRNA sequence AUGCGCAGUCGGUAG. The genetic code Second letter of codon UAU UAC JUU Phenylalanine uCU UUC Phe) UUA Leucine (Leu) UUG Tyrosine (Tyr) GCysteine (Cys) UGC 1oStop codon |UGG Tryptophan (Trp) CGU CGC UcC Serine (Ser) UCA ucc CCU cC Proline (Pro) Stop codon UAG Stop codon CAU Histidine His) CU CUC CUA CUG Arginine (Arg) Leucine (Leu) cca CAA CCA CGA Glutamine (Gin) CAG AUU AUC AUA ACU Isoleucine (le) AAU AAC AGU AGC Asparagine (Asn) Serine (Ser) ACC Threonine (Thr) ACA Methicnine ACC start codon GCU Lysine (Lys) AGA Arginine (Arg) ARC AGS GAU Aspartic acid (Asp)G0 GAC GUU GUC Valine (Val) GCC Alanine (Ab) GG Glycine (Gly GUA GUG GCA GCG GA Glutamic acid (Glu) GA GGG GAG 4 15 First letter of codon Third letter of codon
- The DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'a) b) Shown below is a DNA sequence that encodes for a section of a protein. Please write the amino acid sequence using the three letter codes for this section. 5' ATG ACT CTC TCC TGG GGC ATC CGA TAA 3' What would the second codon be changed to if it was both a silent mutation and a transition mutation? Please write an anticodon in 5' to 3' direction that would recognize both the original second codon and the mutated second codon.The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U P с > < A G U UUU UUC Phe UUA UUG CUU CUC CUA CUG L GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Cys UAA Stop UGA Stop A Trp UAG Stop UGG CAC His CGU J CGC CAA I CGA Gin CAGG CGG AAA 1 AAG Lys UGU UGC AAU Asn AGC} AAC GAC Asp GAA GAGGIU For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph V Arial G 1 AGA 1 AGG GGU GGC GGA GGG Arg Ser Arg Gly V DCAG DCA DOA UCAG Third letter 10pt < Av V IX Q ... O WORDS POWERED BY TINY
- Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-CysAn mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’A mRNA has the following sequence and direction: 5’-AUGUCAACCUAA-3’ What would be the anticodon sequences formed from this mRNA during the translation process?