SCDFeas fillThe diagram below illustrates how recombinant DNA technology isused to produce valuable products. What is the purpose of usingrestriction enzymes in recombinant DNA technology?PDFUNOFFICTRANSCRostly cloudyDNA plasmidsOOBacterial cell (E. coli)BacteriumwithrecombinantDNAplasmidPlasmids isolatedOODOCloned cells producenew protein such asenzymes or hormonesO-CLigase joinssticky endsReplication ofnew gene00 00Restriction enzymecuts plasmidsSticky endsGene obtained fromdonor DNA using thesame restrictionenzymeO The restriction enzymes are used to catalyze the synthesis of newproteins such as enzymes or hormones.Sticky endsO The restriction enzymes are used to join sticky ends of both the cutplasmid and the cut gene obtained from donor DNAPImasomisO Search

Recombinant DNA (rDNA) is the name given to DNA molecules produced using genetic recombination…

The diagram below illustrates how recombinant DNA technology is used to produce valuable products. What is the purpose of using restriction enzymes in recombinant DNA technology? DF RISKIR DNA plasmids DO Bacterial cell (E. coli) Bacterium with recombinant DNA plasmid OO Replication of new gene OO Plasmids isolated OO Cloned cells produce new protein such as enzymes or hormones O-C Ligase joins sticky ends OO Restriction enzyme cuts plasmids Sticky ends Gene obtained from donor DNA using the same restriction enzyme O The restriction enzymes are used to catalyze the synthesis of new proteins such as enzymes or hormones. Sticky ends O The restriction enzymes are used to join sticky ends of both the cut plasmid and the cut gene obtained from donor DNA ma om

The diagram below illustrates how recombinant DNA technology is used to produce valuable products. What is the purpose of using restriction enzymes in recombinant DNA technology? DF RISKIR DNA plasmids DO Bacterial cell (E. coli) Bacterium with recombinant DNA plasmid OO Replication of new gene OO Plasmids isolated OO Cloned cells produce new protein such as enzymes or hormones O-C Ligase joins sticky ends OO Restriction enzyme cuts plasmids Sticky ends Gene obtained from donor DNA using the same restriction enzyme O The restriction enzymes are used to catalyze the synthesis of new proteins such as enzymes or hormones. Sticky ends O The restriction enzymes are used to join sticky ends of both the cut plasmid and the cut gene obtained from donor DNA ma om

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 5DAA: HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952...

See similar textbooks

Similar questions

Synthetic polylinker Hindill EcoRI sticky end 5 AATTCCTGCAGAAGCTTCCGGATCCCCGGG CITAA Plasmid cloning vector (cleaved with Eco) GGACGTCTTCGAAG GCC TAGGGG CCCTTAA AATTC Psti Hindi Nelson & Co, Leninger Principles of Biochemistryde ©2021 WH Freeman & Company BamHI Smal EcoRI sticky end Enzyme Polylinker transferase; 2 ligase; 6 lyase; 6 lyase; 4 ligase; 4 BamHi Smal CITAAG GRATT C EcoRI Which pairing correctly matches the enzyme class and Enzyme Commission number for the enzyme that catalyzes this reaction?
biotechnology lab class :1. The bacterial streaking on antibiotic containing agar plates has been completed and the plates will be available for you to inspect in the lab class.2. You will complete a restriction enzyme digest on the four available plasmid stocks and then examine the products by agarose gel electrophoresis. Photographs of the gel are attached to identify the plasmid present in each analysed sample.Now consider the following questions :- For each of the four plasmids used in the practical, identify the size (in kb) of the linear DNA fragment(s) that you would expect to obtain if the EcoRI digest is complete.- Using the provided negative image of the gel, which shows the bands present in the ND and D samples for each plasmid, identify the plasmid that was present in each of the four plasmid stock.- Explain how you were able to identify plasmid in each sample using the gel, considering how linear DNA fragments of different length are separated by agarose gel…
What type of molecule or cell is PGLO? C Origin region Arabinose operon arac ori Ndel Promoter PaaD PGLO (5,400bp) Ndel Ampicillin Resistance Gene Amp Hindll Ndel Green Fluorescent Protein (GEP) Gene Hindll 'ECORI GraphiceESchmid/2003 D O virus O RNA plasmid molecule O DNA plasmid moelcule O none of the choices are correct
The DNA polymerase used in PCR is taken from Thermus aquaticus, a bacterium that thrives in the extremely high temperatures of hot springs. Why is it necessary to use special DNA polymerase? * bers erences QOnline Thermus aquaticus is accustomed to efficient replication. wsela Thermus aquaticus can survive at boiling and freezing temperatures, both of which are necessary during PCR. ation ogy Periods 1 and 2 "Normal" DNA polymerase would denature in the high temperatures used in PCR. ng periods chool MP1, Highschool Highschool MP3, school MP4 Thermus aquaticus is able to supply a varied amount of bases to the DNA template. tion ting days n Tue Wed Thu Fri Mutations occur randomly during the process of gene expression or by exposure to mutagens. While some mutations are detrimental, others can create proteins that ha n nociti e conahilition In vder fo ra mutation te be n esed tn futuen INTL
Competent E. coli cells were transformed with the pGLO plasmid. These transformed cells were then allowed to grow on two different plates: 1) a plate containing LB/AMP and 2) another plate containing LB/AMP/ARA. In which plate would you observe both phenotypic and genotypic changes? Briefly justify your answer. Edit View Insert Format Tools Table 12pt v Paragraph v BIUA e T?v 田 D2
DNA damage in the form of dimers induced by UV lightcan be repaired by many bacteria using ______ ______ or pho-toreactivation, which occurs when the bacteria get back intothe presence of visible light, or by dark repair, which can occurin the presence or absence of visible light and requires several______ -controlled reactions.
A amp PBR322 4301 fot B Clear Zones Figure 2 The postgraduate student, Demika, inserted her gene of interest into the plasmid, pBR322, before transformation into the competent host cell using heat shock method. After that she cultured the cells on the Ampicillin agar plate before replica plating the colonies onto another Ampicillin (A) and Tetracycline (B) agar plates shown in Figure 2. (1) Referring to the vector pBR322 in Figure 2, which recognition site was cleaved to insert the gene of interest? Based on the observation above, can you identify which colonies are carrying positive mcombinants of BR322? Explain your selection.
Categorize the following as being associated with transformation, conjugation, or transduction. Note that some items may be associated with more than one process. Transformation Conjugation Transduction requires a virus can transfer dead bacterium's DNA to a new host cell efficient way to get naked plasmid into E. coli cells in the lab involves a pilus describes type of horizontal gene transfer in bacteria cells need to be competent process exploitod by biotechnology transfer requires at least two living bacteria alters bacterial genome
Biology Question
Asap
Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHI
You wish to insert a gene in the plasmid below. (Note the neon green lines represent restriction sites.) amp gene BamHI Sacl Saçl EcoRI BamHI 33 BamHI Gene of interest Chromosomal DNA from human cells a) Which restriction enzyme should you use to cleave the plasmid? Explain your answer. b) How would you create a cDNA library for the chromosomal DNA containing the gene of interest? c) The green area on the plasmid is the ampicillin resistance gene. Explain how you would use it to screen for a recombinant plasmid. 1