Quick activity Use the genetic code to translate the following 30 nt mRNA sequence: AUGAUCCUAGGGUGCAUGAUGCCAAAAUAA Prezi 1st letter UUUC UUU Phe UCU U <0 UUA UUG CUU C CUC CUA CUG U Leu UAU UCC Ser UAC UCA UAA UCG UAG CCA CCC Second Letter CCU CAU Leu CCC Pro CAC CAA CAG ACU AUU A AUC lle ACC ACA AUG Met ACG AUA C GCU GUU G GUC Val GCC GUA GCA GUG GCG AAU The AAC AAA AAG GAU Ala GAC GAA GAG A Tyr UCU Cys U UCC His COU Gin G Stop UGA Stop A Stop UGG Trp G Glu CGC Arg CGA CGG DATA DA AGA AGG 3rd Asn AGU Ser U letter AGC Lys Asp GGU GGC GGA GGG Arg C Arg Gly C Gly

Q: What role do baroreceptors play? Select one: O a. They respond to low oxygen levels and direct…

A: The blood pressure and blood volume are regulated by different mechanisms that includes neural…

Q: What are the many types of restrictions

A: Restriction enzyme The enzyme which is use to cut the dna at perticular sequence.

Q: 20: Function Location Description SPECIMEN NAME: Human blood smear

A:

Q: Wintering range Spain typical migratory route of starlings experimental relocation of all starte…

A: Seasonal migration can be defined as the movement of birds from one habitat to another in response…

Q: Question 32 The body system that appears to contain the greatest diversity of microbial organisms is…

A: The greatest diversity of microorganisms would be in :  Option b  Gastrointestinal tract

Q: Glycogen that is broken down in the muscle is not released as glucose into the circulation because…

A:

Q: Part II: Determine the type of inheritance: For each of the following examples, determine the most…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: Question 14 of 25 Which statements best describe serotonin? Select the correct response(s): It is…

A: Serotonin is a chemical that communicates between nerve cells in the brain and throughout the body.

Q: 1. What is the equation for photosynthesis? Label the reactants and the products. 2. In your own…

A: Photosynthesis is the process by which plants use sunlight, water, and carbon dioxide to create…

Q: TEM Identifying Cell Structures (b) (c) (d) (f) (g) (h) (1) (1)

A: Introduction :  The basic structural and functional component of all living things is the cell. It…

Q: You cut yourself, and the cut becomes infected. The cause of this infection is most likely a O a.…

A:

Q: A plasmid was cleaved with several restriction enzymes, individually and in combinations. The…

A: Plasmids include genetic resources, and each plasmid has an attachment site, an identification site,…

Q: If, when faced with an environmental temperature of 42 °C, your core body temperature was raised…

A: Body core temperature is the temperature of the body's internal organs. The average normal body core…

Q: After receiving a heavy dose of antibiotics while in the hospital, a patient experienced continuous…

A: Antibiotics A drug that is use to kill harmful bacteria that invade our body.

Q: The phylogenetic tree of the OCTN homologs below was generated with the following accession numbers…

A: The smaller SLC22 family has a subgroup of membrane transport proteins called OCTN. Two of the…

Q: Think about how we organized the mechanisms of sexual selection (mate competition vs. mate choice;…

A: The ability of an organism to survive and successfully reproduce offspring determines its…

Q: The selection of high performing individuals is the main challenge for breeders. In animals, it is…

A: One of the most crucial areas of animal production is dairy production, where bulls with strong…

Q: If you decided to go and live in the high mountains of the Andes Select one: O a. all of the others…

A: Going to high altitude would cause  The correct option for this would be : a. All of the others are…

Q: In man, the allele for normal color (A) is dominant to the allele for albinism (a). A normal man…

A: Introduction :  Albinusm is an autosomal recessive disorder in which there is reduced or absent…

Q: You were able to grow SARS-CoV 2, how will you go about purifying it?

A: Purifying a protein from a more significant proportion allows for additional studies, such as…

Q: Living things create energy through the breakdown of food into nutrients which the cell can use.…

A: Some animals(Goat, Cow) only eat vegetables, plant products such as leaves etc. They are called as…

Q: What is the importance of the following components of Hay Infusion-paramecium sp culture?   a. hay…

A: Hay infusion is a type of culture medium for growth of microbes.It enables us to study,various…

Q: 7. Water always moves from a hyposmotic/hyperosmotic to a hyposmotic/hyperosmotic (circle or…

A: Introduction :  The magnificent network of transportation networks found in living things is…

Q: What changes in Radiation Protection criteria led to the use of Equivalent dose and Effective dose…

A: Radiation dose is measured as the amount of radiation exposure. There are three kinds of dose…

Q: How does the blood moves from the body and the heart and what is the circulation of the blood? Write…

A: Introduction :- The heart has two atria and two ventricles, making up its four chambers. Blood with…

Q: Cdc5/Polo is a phosphatase. An overactive, gain of function mutation in Mad2 would cause metaphase…

A: Cell signaling pathways can be understood as a series of upstream or downstream chemical reactions…

Q: 3. One form of color-blindness in humans is more common in males, but does occur in females. What…

A: Inheritance, traits, DNA, genes, proteins, and chromosomes are all aspects of heredity. All of us…

Q: 34. The sperm of fish are released into the water and commence swimming to find an egg. The duration…

A: Given  Speed = 100um/s  Time = 2min = 2 × 60 = 120s. Find  Distance travelled.

Q: Gain of Function research, defined as: "medical research that genetically alters an organism in a…

A: Gain of functions Gain of function is an research of  enhancement of organism by adding or altering…

Q: In Silviculture Subject, What are the different kinds of Regeneration

A: Silviculture is the practice of controlling the growth, composition/structure, and quality of…

Q: E> generation 1. Two F₁ parents are crossed to produce the F₂ offspring. RrSs x RrSs What are the…

A: A gene is said to be dominant if it can express itself even when only a single copy of its allele is…

Q: 5. Which of the following is NOT true about channel and carrier proteins? a) Carriers never form a…

A: Please Note: As per the honor code we are allowed to author only one question unless mentioned.…

Q: Question 19 The best description of a prokaryote is that it is O a. typically a unicellular organism…

A: The correct description of a prokaryotic cell is :  A typically unicellular organism between 1 to 10…

Q: 1... Describe the different models for DNA replication (conservative, semi-conservative, dispersive)…

A: The DNA replication is the process by which new DNA is synthesized from the old DNA. In case of…

Q: How do protozoa move?

A: Protozoa:  A group of single-celled eukaryotes, known as protozoa (plural protozoa or protozoans),…

Q: Lecture Exercise 6: Plant Diversity Plants: multicellular or unicellular? Photosynthetic autotrophs…

A: Introduction : One of the most important living things on the planet is the plant. They have…

Q: What facets of the physical and cultural development of man have influenced his or her own learning?

A: Cultural anthropology is a significant branch of anthropology that focuses on the study of culture…

Q: 9. Side A of a tube has a glucose concentration of 100 mOsm. Side B has a NaCl concentration of 100…

A: osmosis is the movement of water molecules from a solution with a high concentration of water…

Q: Parathyroid hormone released from the parathyroid glands: Select one: Oa. exerts similar effects to…

A: Parathyroid hormone is a peptide hormone made up of 84 amino acid and released from parafolecular…

Q: CITRATE TEST This test determines the ability of bacteria to use citrate as source of carbon and…

A: CITRATE TEST This test determines the ability of bacteria to use citrate as source of carbon and…

Q: Which of the following are characteristics of all prokaryotes? Select the correct response(s): ✓ The…

A: Prokaryotes are the unicellular primitive group of organisms characterized with the presence of…

Q: what is the importance of the oxygen in hay infusion paramecium sp culture

A: By the process of hay infusion the microbes can be grown at any time like paramecium species.

Q: Please name the specific structural type of joint indicated by the red arrow. 2. Please name the…

A: This is the pubic symphysis. It is a secondary cartilaginous type of joint.

Q: You need to make 20 mL of a 1/100 (10-2) dilution of a crystal violet solution? How much diluting…

A: Crystal violet or gentian violet, also known as methyl violet 10B or hexamethyl pararosaniline…

Q: What is the likely mode of inheritance in the below pedigree?   Select one: a. Dominant b.…

A: Pedigree is a chart which is made up of symbols and lines that represents the genetic family history…

Q: Let's say there is a protein that needs to be made and then exported out of the cell by exocytosis.…

A: Introduction : Protein synthesis takes place primarily at ribosomes, which is why they are referred…

Q: Most digestion and absorption occurs in the ___ because of ____. a. mouth, teeth b. stomach,…

A:

Q: Question 14 of 25 Which statements best describe serotonin? Select the correct response(s): It is…

A: Serotonin is a chemical that carries messages between nerve cells in the brain and throughout your…

Q: which cell in the human body does Staphylococcus aureus make pores.

A: ANSWER) Staphylococcus aureus is normally found in the human body, it gets colonized over the skin,…

Q: What is true about carotid arteries? a. Carotid arteries carry oxygenated blood to the brain b.…

A: The brain, neck, and face are all supplied with blood through the neck's large carotid arteries.