QUESTION 21 You have the following coding sequence for a gene and need to generate billions of copies to study it. Which of the following are correc? 5'ACCGACTATGCGGACTACGCGGGATCAAGGATCTGACT3' PCR can be used as a technique to generate copies of the sequence Polymerase chain reaction can be used as a technique to generate copies of the sequence ANTPS are needed in the reaction mix rNTPs are needed in the reaction mix DNA primers are used in the reaction mix RNA primers are used in the reaction mix The primers 5'ACCGA3' and 5'TGACT3' would allow amplification of the entire sequence above The heating step breaks phosphodiester bonds and allows each strand to serve as a template strand Human DNA polymerase would be used for the reaction mix but it is difficult to harvest from human cells Human DNA polymerase is denatured and rendered nonfunctional during the first step of the reaction cycle
Molecular Techniques
Molecular techniques are methods employed in molecular biology, genetics, biochemistry, and biophysics to manipulate and analyze nucleic acids (deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)), protein, and lipids. Techniques in molecular biology are employed to investigate the molecular basis for biological activity. These techniques are used to analyze cellular properties, structures, and chemical reactions, with a focus on how certain molecules regulate cellular reactions and growth.
DNA Fingerprinting and Gel Electrophoresis
The genetic makeup of living organisms is shown by a technique known as DNA fingerprinting. The difference is the satellite region of DNA is shown by this process. Alex Jeffreys has invented the process of DNA fingerprinting in 1985. Any biological samples such as blood, hair, saliva, semen can be used for DNA fingerprinting. DNA fingerprinting is also known as DNA profiling or molecular fingerprinting.
Molecular Markers
A known DNA sequence or gene sequence is present on a chromosome, and it is associated with a specific trait or character. It is mainly used as a genetic marker of the molecular marker. The first genetic map was done in a fruit fly, using genes as the first marker. In two categories, molecular markers are classified, classical marker and a DNA marker. A molecular marker is also known as a genetic marker.
DNA Sequencing
The most important feature of DNA (deoxyribonucleic acid) molecules are nucleotide sequences and the identification of genes and their activities. This the reason why scientists have been working to determine the sequences of pieces of DNA covered under the genomic field. The primary objective of the Human Genome Project was to determine the nucleotide sequence of the entire human nuclear genome. DNA sequencing selectively eliminates the introns leading to only exome sequencing that allows proteins coding.
Polymerase chain reaction (PCR) is a fast in vitro method to amplify a given DNA sequence present in a given DNA source. It is technique formulated to amplify a selective region of DNA sequence in the entire genome. To get a lot of the desired DNA sequences, a primer needs to be made which is an oligonucleotide of high specificity to the target sequence. It should be about 15-25 nucleotides ling. The DNA are denatured to get the templates to which the primer binds. Using a heat-stable polymerase Taq polymerase and dNTPs (deoxynucleoside triphosphates), the synthesis of the new strand begins.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
