Question 19 The polymerase chain reaction requires the following except A primers complementary to the ends of the sequence to be amplified (B) carefully controlled temperature conditions C) cycles of denaturation, annealing and extension D) RNA polymerase to synthesize RNA primers
Q: The genes for waltzer (v) and jittery (ji) are 18 map units apart on chromosome 10 in mice. A…
A: To produce mice with the desired genotype of waltzer, jittery, and waltzer + jittery, we need to…
Q: Why Eukaryotes is better than prokaryotes?
A: Introduction : Prokaryotes are most primitive and simple organisms. They lack double membrane-bound…
Q: Different populations of Dr. Remington's rock cress plants (Arabidopsis lyrata) are pure-breeding…
A: Data from several populations of Dr. Remington's rock cress plants (Arabidopsis lyrata) that are…
Q: 11. The following is a list of abiotic factors that would have a micro-effect on a tidal pool (rocky…
A: Answer :Water chemistry ( pH ,pollution etc) Reason: Abiotic factors are ecological elements that…
Q: If a particular cell type requires two passes through a Manton-Gaulin homogenizer to achieve a R of…
A: Introduction Cells are the basic unit of life and the smallest structural and functional unit of…
Q: Duckweed is a tiny floating aquatic plant that can reproduce so rapidly that it can completely cover…
A: Introduction : The process of preparing food when exposed to sunlight and chlorophyll is known as…
Q: evolution from lamprey to human
A: Evolution is the process of change over time that occurs in living organisms, populations, and…
Q: The frequency of the defective allele of a gene for an autosomal recessive disorder is 1/10. In a…
A: Introduction :- An autosomal recessive disorder is a genetic condition caused by the inheritance of…
Q: During hibernation, norepinephrine is produced by the brain and released into the bloodstream. Based…
A: Hibernation: Several animal species enter a condition of hibernation, which includes reduced…
Q: 9:57 Go ← _5069_L03_MitosisAndMeiosis.docx AD Post-Lab Questions 1. Label the arrows in the slide…
A: Introduction :The collection of events that occur in a cell that enable it to grow and then divide…
Q: June Johnson is a 55-year-old female who was admitted to the hospital during two hours of crushing…
A: Afterload is the resistance that the heart must overcome in order to eject blood during systole (the…
Q: What is the mode of inheritance for the following pedigree? Drag the correct answer to the rectangle…
A: A pedigree chart is a diagrammatic representation of either phenotypes or genotypes of a particular…
Q: Analyze the fly wing (left) and the bird wing (right). Are these structures homologous or analogous?…
A: Homologous structures are body parts in different species that have the same fundamental structure…
Q: In relation to DNA Isolation experiment 1. Once the tissue has been ground and heated to 60°C, the…
A: Introduction :- Proteases are enzymes that break down proteins by hydrolyzing peptide bonds between…
Q: 17. Human plasma-derived products characteristics. The application of human plasma-derived products…
A: Plasma is the liquid component of blood that makes up about 55% of the total volume of blood in the…
Q: give the function of these stingray parts. 1. eye 2. snout 3. mouth 4. nostril 5. spiracle 6.…
A: Across the world, temperate and tropical marine and freshwater ecosystems are home to the…
Q: Why eukaryotes is better than accellular organisms?
A: Introduction Organisms are individual living entities that exhibit characteristics of life, such as…
Q: A young boy acts more aggressively than a young girl of the same age. Which biological factor is…
A: Hormones are chemical messengers secreted by endocrine glands, specialized cells, or neurons. They…
Q: Normal pigmentation in humans is completely dominant to albinism. A couple who are both carriers for…
A: Albinism is a group of inherited genetic disorders characterized by a lack of melanin, the pigment…
Q: centromeric DNA is known as ____ and may be located in several locations on the chromosome. if there…
A: Centromeric DNA: Centromeric DNA is the DNA that makes up the centromere, a specialized region of a…
Q: The process of the body "catching up" and becoming less top-heavy by around age 5 occurs as a result…
A: Introduction: The natural process of bone growth that takes place during development and throughout…
Q: QUESTION 20 Which of the following does NOT function as a second messenger in cell signaling…
A: Insulin is a hormone produced by the pancreas that helps regulate glucose levels in the blood. It…
Q: What is a physiologic characteristic common among majority of cocci that relates to their grouping?…
A: Introduction: Bacteria are unicellular microorganisms that are found in a wide range of…
Q: who do not carry
A: Cystic Fibrosis (CF) is a genetic disorder that is inherited in an autosomal recessive pattern,…
Q: Make a Research Gap on the topic "Habitat Niche Partitioning of Anurans in Waterfalls". Cite your…
A: Habitat: A habitat is the natural environment or home of a particular organism or group of…
Q: 7. What effect did the carboxymethylcellulose have on the organisms and why? Organism Algal sample…
A: Introduction Carboxymethylcellulose, also known as CMC, is a water-soluble cellulose derivative…
Q: This UCP1 protein allows the protons (H+) of the mitochondrial intermembrane space to enter the…
A: UCP1 is a unique protein that plays a critical role in thermogenesis and energy balance, and it may…
Q: William is a 13-year-old who is having frequent night terrors. William's parents take him to the…
A: Night terrors are episodes of screaming, extreme fear, and thrashing while a person is still asleep.…
Q: Which of the following steps (on this page and the next page) would be necessary to determine the…
A: The Disk Diffusion Assay is a laboratory test used to determine bacterial antibiotic sensitivity. In…
Q: Based on the Eurachem guide on fitness for purpose, how are bias and precision defined. What are the…
A: Fitness refers to the overall state of health and physical well-being of an individual. It involves…
Q: On the base of ECG analyses define what structure is the pacemaker of heart. Explain why you think…
A: We are given an ECG strip and we have to comment on which structure is the pacemaker.
Q: 6. Draw a simple graph that illustrates the general relationship between organism size and…
A: Population is the term usually used to refer to the number of individuals in a area and the number…
Q: Give an example of a journal that is about genetic switches involving rna molecules. Give the…
A: A journal is a publication that contains articles or papers written by experts or researchers in a…
Q: Which of the following is/are possible disadvantage(s) of intravenous (IV) delivery?…
A: Introduction :- Hemolysis is the destruction of red blood cells, which can lead to the release of…
Q: A special diet led to a decrease in Ca2+ ions in the blood. To increase the secretion of which…
A: Introduction A hormone is a chemical messenger that is produced by an endocrine gland, released…
Q: Give the different types of reflexes and explanation . Tabulate your answer.
A: Introduction Reflexes are involuntary, automatic responses of the nervous system to a particular…
Q: The 100-milligram dose of vitamin C provided by this dietary supplement is and why 1 less than…
A: Vitamin C, also known as ascorbic acid, is a water-soluble vitamin that plays several important…
Q: What is the methodology in RNA Biology | Taylor & Francis Online
A: The question asks about the methodology used in RNA Biology. It wants to know the techniques and…
Q: F. If a man who is heterozygous marries a woman who is homozygous recessive, what and phenotypes of…
A: In genetics, the terms homozygous and heterozygous refer to the genetic makeup of an individual with…
Q: Why does it make sense to look for ARGs and not antibiotic-resistant organisms themselves?
A: Antibiotic resistance genes (ARGs) are segments of DNA that encode for proteins or enzymes that…
Q: Decide which sentences describe natural selection and which are common misconceptions. True…
A: Natural Selection: Natural selection is a process by which certain heritable traits become more or…
Q: What organelles are these and what are their functions?
A: Cell organelles are specialized structures within a cell that perform specific functions necessary…
Q: Two human populations have been isolated on islands since their ancestors first arrived. The mtDNAs…
A: Mitochondrial DNA (mtDNA) is a circular DNA found in the mitochondria of cells. It is only inherited…
Q: Why do we make the differences between large carbohydrates, proteins, and nucleic acids?
A: Each of these biomolecules possesses distinct properties that make them well-suited for their…
Q: Molecule X MMP-2 cleavable sequence Molecule Y
A: The imaging agent in the figure consists of two molecules - molecule X (donor) and molecule Y…
Q: 1. What is the state of DNA at the end of meiosis I? What about at the end of meiosis II? 2. Why are…
A: Note :- Since you have asked multiple questions im only answering the ist 3 as per bartleby…
Q: D. A. B. 10. C. Familial hypercholesterolemia is the most common genetic cause of heart disease. It…
A: We need to understand the basic concepts of genetics and also consider how these traits are…
Q: Identify two ways meiosis contributes to genetic recombination? Why is it necessary to reduce the…
A: Introduction :- Meiosis is a type of cell division that results in the formation of gametes, such as…
Q: Phenylalanine (Phe): Codons 5'-UUU-3' and 5'-UUC-3' Cysteine (Cys): Codons 5'-UGU-3' and 5'-UGC-3'…
A: Introduction The genetic code is made up of a set of codons, which are sequences of three…
Q: 1) What does the 4-Part Cnidarian Model show you about the body plan, tissues and c of cnidaria?…
A: Cnidaria is a phylum under the kingdom animalia that contains both freshwater and marine organisms.…
Step by step
Solved in 3 steps
- Question 3 In the polymerase chain reaction (A) conditions must be carefully controlled to prevent explosions. (B) reaction mixtures must be kept chilled at all times. C) it is possible to amplify small amounts of DNA without cloning. (D) primers should have a high G-C content and Tm at around 95°CQuestion 39 The graphic below shows Taq polymerase extending the primer upon a strand of DNA. What is a possible resulting sequence of the complementary strand after the reaction is finished assuming adequate amounts of all normal nucleotides and some ddGTP? 5' 5' O GATGC O TGCG O ATGC AGATGC с POLYMERASE 3" T G C '5' 3º inQUESTION 21 Choose each of the characteristic(s) of all RNA polymerases from the list below. A. elongation adds new ribonucleotides to the 3-OH B. requires a primer to initiate synthesis C. have 3' to 5' exonuclease activity D. adds nucleotides based on sequence complementarity to a template E. have 5' to 3' polymerase activity O F. elongation adds new ribonucleotides to the 2'-OH G. have 3' to 5' polymerase activity
- Procedure 1. 2. 3. 4. 5. 6. Fill in the data table below. Complete column B by writing the correct mRNA codon for each sequence of DNA bases listed in the column marked DNA Base Sequence. Use the letters A, U, C, or G. Identify the process responsible by writing its name on the arrow in column A. Complete column D by writing the correct tRNA anticodon that bonds to each mRNA codon from column B. Identify the process responsible by writing its name on the arrow in column C. Translate the mRNA codons from column B into amino acids in column E using the table. Data Table DNA base sequence AAT GGG ATA AAA GTT A Process B mRNA codon с Process D tRNA |anticodon E Amino acidQuestion 18 Which of the following activities of DNA pol I is MOST important in proofreading? A) 5' to 3' exonuclease B polymerase activity ligation activity (D) 3' to 5' exonucleaseQuestion 10. Which statement on the migration of DNA fragments through agarose gels is false A) Small fragments migrate faster than larger fragments because they can move faster through the agarose pores. B) Large fragments migrate faster than small fragments because they carry more negative charges. C) DNA fragments migrate towards the positive pole. D) Supercoiled DNA may migrate significantly different through the gel than linear DNA of equal size. E) The higher the agarose concentration the better the separation of smaller fragments as compared to larger fragments.
- Question 30 Which of the following correctly describes a difference between RNA & DNA polymerases? (A) RNA polymerases usually do not need a template, while DNA polymerases do. B DNA polymerases usually require a primer while RNA polymerases do not. RNA polymerases usually synthesize introns, while DNA polymerases synthesize cistrons. D RNA polymerases polymerize 5' –> 3', while DNA polymerases polymerize 3' –> 5'.Question 7 Referring to the plasmid below, if a recombinant plasmid were obtained by inserting DNA into the EcoRv site, and the protein corresponding to the recombinant gene were expressed, which of the following statements would be false? Aval Sall A The plasmid will be resistant to tetracycline. B) The protein is not likely to be biologically active without some further treatment. C) The plasmid will be resistant to ampicillin. (D) The plasmid will not be able to replicate autonomously. Pul- Poul- ampr III EcoRI EcoRV BamHI pBR322 (4363 bases) -Poudl lettQuestion 15 When you successfully inserted a gene fragment into the Hindill site and transform bacteria with the plasmid. How can you tell which transformants have the insert? ... The plasmid PSU922 is a circular DNA containing 25000 base pairs. The B-gal gene codes for the enzyme ß-galactosidase, the product of which will turn bacterial colonies blue when grown in the presence of X-gal; the Amp gene confers ampicillin resistance. EcoRI Bam HI BamHI HindIII PSU922 BamHI Bam HI EcoRI ori C (A) The bacteria will not be able to grow in the presence of ampicillin, and they will be blue. B) The bacteria will not be able to grow in the presence of ampicillin, and they will be white. (C) The bacteria will be able to grow in the presence of ampicillin, and they will be white. (D) The bacteria will be able to grow in the presence of ampicillin, and they will be blue. AmpR F-gat
- These questions relates to DNA extraction, the choices are in the attached photos (i) Sanger sequencing originally used 4 lanes in gels. These lanes represented sequences of different lengths obtained by adding: (ii)Which of the following gels is the preferred choice for separation of DNA fragments?QUESTION 1 The sequence of a DNA including the gene that you want to clone into a plasmid vector. The gene of interest is in bold with the stop codon shown in green. The sequence has no suitable restriction site for digestion to isolate the gene fragment for cloning. Recognition site of Sal-I enzyme is given below. Design a primer to introduce the Sal-I site to the beginning of the gene. Write the complementary DNA sequence Design the primer and show which strand of DNA it is complementary to Mark the direction of all DNA sequences including the primer. 5-TGTCAGCACCATCTGTCCGGTCCCAGCATGCCTTCTGAGACCCAGGCAG(1500b)TGGGGCTGACTCTTTA-3 Sal-1 recognition site GTCGAC CAGCTG THIS IS COMPLETE QUESTION. PLEASE EXPLAIN EACH PART OF GTHE QUESTION.Question 16 Advantages of using the PCR include the following EXCEPT A it will always give the desired product B it can target desired sequences from either genomic or cDNA templates (C) the reaction is specific to a desired DNA sequence (D) only small amounts of template are needed