Question 1. Restriction endonucleases can be isolated from a number of bacteria. In bacteria restriction endonucleases. a-restrict chromosomal DNA that is heavily mutated b-restrict chromosomal DNA with significant regions that have been Deleted. c-restrict the DNA of invading bacteriophages. d- all of the above Question 2. In a PCR reaction the step in which DNA polymerase replicates the DNA is referred to as a- denaturation b- annealing C- extension d- initiation

Question 1. Restriction endonucleases can be isolated from a number of bacteria. In bacteria restriction endonucleases. a-restrict chromosomal DNA that is heavily mutated b-restrict chromosomal DNA with significant regions that have been Deleted. c-restrict the DNA of invading bacteriophages. d- all of the above Question 2. In a PCR reaction the step in which DNA polymerase replicates the DNA is referred to as a- denaturation b- annealing C- extension d- initiation

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 8QP

See similar textbooks

Similar questions

Some Steps Involved in Creating Recombinant DNA 1. Plasmid DNA is cut at the restriction site.2. Foreign DNA is cut at the restriction site.3. Plasmid DNA is opened and sticky ends are formed.4. Foreign DNA restriction fragments are isolated5. Target sequence in the plasmid is recognized by the restriction endonuclease.6. Target sequences in the foreign DNA are recognized by the restriction endonuclease.7. Foreign DNA restriction fragment is inserted into the plasmid at the restriction site.8. DNA ligase splices the foreign restriction fragment and the plasmid together. Identify the correct sequence of steps involved in cutting and reassembling DNA molecules to make recombinant DNA. Start with preparation of the plasmid DNA. Select one: a. 6, 2, 4, 7, 8, 5, 1, 3 b. 5, 1, 3, 6, 2, 4, 8, 7 c. 5, 1, 3, 6, 2, 4, 7, 8 d. 6, 2, 4, 5, 1, 3, 8, 7
Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest? b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect? 2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and indicate whether those pieces would have blunt or sticky ends. NOTE: in the given recognition sites, the dash represents where the cut is made. a) HpaI, recognizes 5’ GTT – AAC 3’ 5’ GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3’ 3’ CCTACAATTGTTAGAGATGCCCAATTGTGGGAACCCAATTGTAGGCGCC 5’ Number of fragments of DNA:…
A Moving to the next question prevents changes to this answer. Question 1 Which step is NOT included in the technique called Southern blotting? O a. visualization by autoradiography or fluorescence imaging Ob. exposure to a 32p-labeled DNA probe Oc amplification of the restriction fragment-probe duplex d. hybridization of the probe with a restriction fragment having a complementary sequence Oe transfer of the mixture of restriction fragments into a membrane composed of nitrocellulose &Moving to the next question prevents changes to this answer. MacBook Pro esc Q Search Secure Search %23 2 & LO % 4
QUESTION 9 which one of these is not required for performing PCR OA template O B. DNA bases OC Reverse transcriptase O D. Primers O D. DNa polymerase
Question 5: Try cutting Plasmid 1 with Xhol. Xbal. Kpnl, and Pstl. Try cutting with all 4 together." Would these enzymes be helpful and informative for creating a restriction map?-Why, or Why not?
Part 2. PCR 1) In one color, write out the forward primer (5’ GATAC 3’) in the correct position relative to the given template DNA sequence. In a second color, act as the polymerase and fill in the rest of the new strand of DNA Primer/New Strand Template DNA: 3’ TAGCTATGCGGACCTCATGCATTAGAGTAG 5’ Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest? b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect? 2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and…
For each question you will have to either make a piece of DNA to complement the DNA template or synthesize a piece of mRNA and give the amino acid sequence of the protein. Highlight the mutation on the mRNA sequence. You can use question 1 as a reference point. Be specific when about the type of mutation example: missense mutation, frameshift mutation... Question 1 DNA TEMPLATE: 3 'GCA TTT GAT AAA TAC CTG AGA TGA CTG ATT GGG GGC AAA 5' 5' CGT AAA CTA TTT ATG GAC TCT ACG GẠC TẠA CCC CCG TTT 3' 1. Synthesize a piece of DNA to complement the template: - Previous ort sc delete 40 PPA 1& backspace
5) Answers to the following questions. A. You are given a tube containing 275 ng of purified PCR product (DNA) that is 1262 bp long. How many picomoles of PCR product are in the tube? The average weight of a deoxynucleotide monophosphate is 328 g/mol. B. You digest a 5 kb plasmid with two enzymes that yield fragments of 4 kb and 1 kb, and resolve the digest on the gel. What would you predict to see in terms of the intensities of the bands?
QUESTION 1: The 2x PCR Master mix (listed on p. 62+63) has four main components. Two of these are PCR Buffer and MgCl2. Based on your knowledge of DNA replication and PCR, what are the other two components and what are their functions? Component 1: Function: Component 2: Function:
Question 2. Retroviruses are used in gene therapy. The goal of gene therapy is to insert in the patient genome a copy of a functional gene that is defective in the patient. Since Retroviruses integrates their genome into the host genome they are ideal gene therapy delivery systems. What would be a potential risk of this type of treatment? The individual treated could be more susceptible to infection by other retroviruses Insertion of the retroviral genome into the host genome can cause dangerous mutations. There are not recognized risks with this gene therapy approach. Genes from the host can be inserted into the retroviruses and laterally moved to other cells.
5. Watch the video: https://www.youtube.com/watch?v=ml0Fo9kaWqo&t=38s. Based on the information in this video and material covered in class answer the following questions: A. In a Sanger sequencing-based PCR reaction, how many primers are added? B. In a Sanger sequencing-based PCR reaction, which molecules are more common: DNTPS or fluorescent terminators? C. What is a typical length of sequence that can be acquired using traditional (Sanger) sequencing? D. The results from sequencing one stretch of DNA is called a "read". How many reads can be obtained from a run on a 384-well plate Sanger sequencing instrument vs. a NovaSeg instrument? E. How many gjgabases of sequences can be obtained on the Sanger vs. NovaSea instruments? Regarding F. and G., the adaptor sequences have two parts: primer binding sites and capture sequences. F. Once the (denatured) DNA has been loaded into the flow cell, which adaptor sequence part is hybridized to other single-stranded DNA first? G. How many copies…
QUESTION 5: Should PCR primers be complementary to each other? Explain the reasoning for your answer.