Pre-tRNA,Met tRNA, Met No DNA Mutant gene Wt gene M 1 2 3 4 5 6 7 8 9 1. Why was [a-32PIGTP used in this experiment? 2. What material generates the smear in the upper region of the autoradiograph? Why is this smear absent from the marker? 3. How does the mutation affect the transcription of the microinjected gene? 4. How does the mutation affect the processing of the primary transcripts? 5. How does the mutation affect the nucleocytoplasmic transport of tRNA Met? Samples: Marker M: 32P-labeled primary transcript No exogenous DNA injected 1: whole oocyte 2: nuclei 3: cytoplasm Mutant gene injected 4: whole oocyte 5: nuclei 6: cytoplasm Wild-type gene injected 7: whole oocyte 8: nuclei 9: cytoplasm

Pre-tRNA,Met tRNA, Met No DNA Mutant gene Wt gene M 1 2 3 4 5 6 7 8 9 1. Why was [a-32PIGTP used in this experiment? 2. What material generates the smear in the upper region of the autoradiograph? Why is this smear absent from the marker? 3. How does the mutation affect the transcription of the microinjected gene? 4. How does the mutation affect the processing of the primary transcripts? 5. How does the mutation affect the nucleocytoplasmic transport of tRNA Met? Samples: Marker M: 32P-labeled primary transcript No exogenous DNA injected 1: whole oocyte 2: nuclei 3: cytoplasm Mutant gene injected 4: whole oocyte 5: nuclei 6: cytoplasm Wild-type gene injected 7: whole oocyte 8: nuclei 9: cytoplasm

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 37CTQ: An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding...

See similar textbooks

Similar questions

48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
Coding With the given coding strand perform the following 1. supply the correct non- coding strand 2. Identify the location of following restriction enzyme by enderlining it in the coding strands 3. Supply the correct non-coding strands for the two restriction enzymes EcoRi - 5' GAATTC 3'BamH1 - 5' GGATTC 3' 5' ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATTCTATGCCCGAATGTC 3'
GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…
Match the following (most appropriate combinations): Gel filteration chromatography Electrophoresis Transition mutation Transversion mutation Missense mutation Frameshift mutation Southern blot Northern blot Western blot Separation of molecules in el [Choose ] Detection of protein Detection of RNA Causes triplet codons to be out of phase Detection of DNA Separation of molecules in electric current ✓ G changed to T C changed to T Separation of proteins in a column based on size Changes one amino acid codon into another Changes one amino acid co Detection of DNA Detection of RNA Detection of protein
Transcribe and translate the mutated sequence # 2. Determine the consequence, if any, for each mutation. You wi ISN. Practice with both charts. Original DNA sequence: mRNA transcript: amino acids: Mutated DNA sequence #2: mRNA transcript: (Circle any changes) amino acids: Type of mutation (Circle one.) How did the mutation affect the amino acid sequence (protein)? (Circle all that apply.) #ARG Point TAC AUG METH TAC Silent (No change) || || CUG #PRO ACC UGG TRP GAC Substitution Missense (1 amino acid changed) #AUG TTG AAC ASN ASN CTT Nonsense (Premature stop) signal GCG CGC ARG GGC Frameshift No stop signal ACG UGC CYS GAC GAC # CCG #GAA #GLU Inserti 1 amino ac added/ deleted LE
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:
To determine the reproducibility of mutation fre-quency measurements, you do the following experiment.You inoculate each of 10 cultures with a single E. coli bac-terium, allow the cultures to grow until each contains 106cells, and then measure the number of cells in each culturethat carry a mutation in your gene of interest. You were sosurprised by the initial results that you repeated the experi-ment to confirm them. Both sets of results display the sameextreme variability, as shown in Table Q5–1. Assuming thatthe rate of mutation is constant, why do you suppose thereis so much variation in the frequencies of mutant cells indifferent cultures?
GCT GAC ATC CTC CTC mutated DNA sequence mutated mRNA sequence mutated amino acid sequence Above is the mutated DNA sequence for part of the 21 hydroxykase gene. Provide the mutated mRNA and amino acid sequence.
B 6000 5100 Number of Fragment(s) 4000 100 pX 6000 bp 3000 A A 1500 2000 A B 10. Based on the restriction map of the above plasmid, determine the number of DNA fragment(s) and the size(s) of the fragment(s). Digestion with Enzyme A Enzyme B Enzyme C Enzyme A + B Enzymes A + C Enzyme B+ C Enzyme A + B + C Fragment size(s) in base pairs
BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
www D le C 3⁰ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F) in the space provided 1. The name of this process is best known as Rho dependent termination 2. The enzyme C called DNA polymerase incorporates ribonucleotides into B called the mRNA False 3. The DNA region A contains inverted palindrome sequences which results in formation of a stem-loops structure 4. During this process, the structure D called terminating hairpin forms and increases the enzyme affinity which terminates transcription