Modify isoleucine to show the predominant forms at pH 1, 7, and 13. Isoleucine has p?ap�a values of 2.4 (carboxyl group) and 9.7 (amino group).
Q: Q. How to judge which amino acids are more hydrophobic vs hydrophilic?
A: The hydrophobicity and hydrophilicity of amino acids determine their biological behavior. These…
Q: 87.Explain how ethidium bromide binds to the DNA and how this chemical makes DNA visible?
A: Molecular biology uses fluorescent intercalating agent ethidium bromide to visualise and stain DNA.…
Q: Calculate the molecular mass of palmitic (hexadecanoic) acid (a fatty acid with formula C₁6H32O2).…
A: Molecular mass is the compound which consists of different atoms.It is calculated by taking the mass…
Q: True or false: A cell with an energy charge below 0.8 will most likely be upregulating…
A: The energy charge of a cell refers to the ratio of high-energy phosphate compounds like ATP…
Q: Glycolysis and Gluconeogenesis are regulated through differential regulation a) What does…
A: Glycolysis and Gluconeogenesis are 2 metabolic pathways that run in opposite directions, with…
Q: cyanogen bromide for c trypsin will cleave b what thing will be cleave site a and d?
A: The proteases are enzymes that are capable of hydrolyzing peptide bonds in substrate proteins.This…
Q: A patient is suspected of having low stomach acid, a condition known as hypochloridia. To determine…
A: Acids and bases are two chemical substances that react with each other to form a salt and water.…
Q: a) A protein gains a mutation of a surface exposed residue. The mutation is Arg --> Leu. Based on…
A: Proteins play a critical role in our body. They form enzymes, antibodies, and structural components,…
Q: Which of these amino acids is a hydrophobic amino acid? (Select all that apply, if necessary.) A. B.…
A:
Q: Consider a protein in which a negatively charged glutamic acid side chain (pKa=4.2)(pKa=4.2) makes a…
A: The Henderson-Hasselbalch equation relates the pH of a solution to the pKa of a weak acid and its…
Q: 852. what is the difference between maltose maltase, sucrose-sucrase and lactoselactase?
A: The body uses carbohydrates for energy. From simple sugars to complex starches, they are found in…
Q: Which of the following amino acids are more likely to be on the interior of the protein? And which…
A: Amino acids are classified as hydrophobic, hydrophilic and neutral based on the property of the side…
Q: 9. Identify the structures in the following pictures of various features in the structure of HEWL:…
A: A.Quaternary Structure:The quaternary structure of a protein refers to the arrangement and…
Q: For the enthalpy (H) factor to become favorable, the enthalpy of the products should be O Higher…
A: The question is to identify the condition of enthalpy of product with respect to reactants when the…
Q: Supposed you used the enzyme lyase in the biomolecular laboratory, identify reaction that you have…
A: Enzymes can be described as catalysts of biological origin. Enzymes facilitate the acceleration of…
Q: Calculate the net charge of the following peptide at pH 2, pH 6 and pH 14 (use 2 and 9 as pKa values…
A: The ionizable groups in a peptide include its N-terminal alpha-amino group, C-terminal…
Q: 165. Explain why the direction of movement of fluid in the manometer was different during yeast…
A: Respiration, the fundamental process by which living organisms generate energy, has revealed…
Q: In patients with Lesch Nyhan Syndrome, purine nucleotides are overproduced and over excreted. The…
A: The body creates purines through de novo synthesis. Hypoxanthine-guanine phosphoribosyltransferase…
Q: Question. Explain the signal transduction mechanism for slow ligand-gated ion channels.
A: Signal transduction mechanisms convert extracellular signals into many cellular responses,…
Q: Draw a diagram of the tetrapeptide Asn-Trp-Met-Ala (show all side chains and draw all peptide bonds…
A: Amino acids are the building blocks of proteins. A peptide bond is formed between the carboxy…
Q: Which enzyme catalyzes the following activation of fatty acid reaction, prior to beta oxidation?…
A: Beta oxidation is the metabolic pathway that catabolises the fatty acids into acetyl CoA that enters…
Q: iii) Draw a structural diagram of a hydrogen bond between β-D-glucose and the side chain of any…
A: iii) Firstly we need to understand the polar residues of a protein. The polar residues of a protein…
Q: Some characteristics of three proteins are listed in the table below: Protein Molecular Weight…
A: Chromatography is a separation technique that separates a mixture of analytes based on their…
Q: Draw the structural formula for adenine and thymine bonded together with hydrogen bonds as they…
A: DNA is deoxy ribo nucleic acid which is a genetic material present inside the nucleus of every…
Q: Which among the several mechanism below applies to the enzyme phenylalanine hydroxylase? A.…
A: B. Activation by phenylalaninePhenylalanine hydroxylase is activated by its substrate,…
Q: - Multiple choice 1. Which of the following choices is correct about the active site of an enzyme?…
A: The area of an enzyme where the substrate is bound is called the active site. It is created from…
Q: The ionization of p-nitrophenol is shown below (pKa = 7.0): a. Identify the weak acid and conjugate…
A: Since you have posted multiple questions with multiple sub parts, we will provide the solution only…
Q: 12. Enzymes are biocatalysts that speed up a chemical reaction in biological systems. The path from…
A: Proteins are large high molecular weight molecules and have diverse functional roles to play in a…
Q: Draw the structure of lysine in the protonation state that would predominate at pH 9.5.
A: Amino acids are the building blocks of polypeptides and proteins.Humans have 20 different amino…
Q: Where is the N-terminus of this peptide? Left Middle Right b) What type of secondary structure is…
A: The primary structure of a polypeptide ( or simply a peptide) is its amino acid sequence from the N…
Q: lace the description with the appropriate step in the enzymatic reaction.
A: Enzymes act as biological catalysts by speeding up the rate of chemical reactions. Enzymes act upon…
Q: Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Terms…
A: Nucleotide metabolism is the set of biochemical reactions that involve the synthesis and breakdown…
Q: A buffer solution is composed of 1.00 mol of acid and 1.75 mol of the conjugate base. If the p pH of…
A: The pH of a buffer solution is determined by the balance between the concentration of the weak acid…
Q: Energy Conversion Problem 1. a) Influence of concentration on the free energy change. In frog…
A: For the chemical reaction:aA + bB -> cC + dDThe reaction quotient Q is calculated as:Q = ([C]^c *…
Q: 12. WHAT IS PROTEIN EXTRACTION FROM CELLS AND WHY IS THIS METHOD IMPORTANT?
A: Basic laboratory techniques isolate proteins from biological samples like cells and tissues using…
Q: What is the hydrogen bonding pattern within an alpha helix? a. Lone pair on C=O of residue i to…
A: We have to determine the hydrogen bonding pattern within an alpha helix
Q: 12. Receptor immobalization on surfaces for developing bio-sensors
A: Immobilizing receptors on surfaces is essential to developing biosensors, which detect and quantify…
Q: Information about poison
A: Poisons are toxic substances or chemicals which interfere the biological process and lead to failing…
Q: Eukaryotic cells contain many compartmentalized organelles. Label the organelles in this eukaryotic…
A:
Q: 6. A quantitative amino acid analysis reveals that bovine serum albumin (BSA) contains 0.58%…
A: Amino acids, such as glycine, tryptophan, and alanine are organic molecules that contain an amino…
Q: 367. Describe the two main mechanisms of intercellular communication and know which is the most used…
A: The two main methods of intercellular communication are direct (juxtacrine) and indirect (paracrine,…
Q: Recall that when we calculated the fraction of estrogen receptors occupied in the presence of 1 nM…
A: To calculate the concentration of free receptor (Rfree) in terms of the total concentration of…
Q: 1. In a catabolic pathway, metabolite X gets converted into metabolite Y, metabolite X metabolite…
A: is the standard change in Gibbs free energy i.e. the change in Gibbs free energy under standard…
Q: 48. Explain the many effects of increases in intracellular calcium ion concentrations.
A: Ca2+ signalling molecules regulate many cellular processes. They transmit extracellular signals to…
Q: Place each charge form of alanine under the pH condition where it would be the predominant form. The…
A: Alanine is a nonpolar amino acid. Amino acids are biomolecules that have an amino group, a carboxyl…
Q: hosphate buffered saline (PBS) is a buffer solution commonly used in biological The buffer helps to…
A: The ionization process of concern here is represented below.H2PO4- HPO4-2 + H+Here, H2PO4- is the…
Q: A supplement that improves alertness
A: Alertness is a state of heightened awareness and wakefulness. It involves neurotransmitter activity,…
Q: The process by which messenger RNA codes for the synthesis of a specific protein is called: a)…
A: The central dogma of molecular biology is a theory that states that the genetic information encoded…
Q: xplain the structure and components of a typical URI. Provide examples of common URI schemes.
A: A URI (Uniform Resource Identifier) is a string of characters that uniquely identifies a resource…
Q: H CH₂ HỎ=CH. CH₂ H₂C (5) H CH₂ H₂C CH₂ CH₂ CH₂ ΝΗ C=NH NH₂ a) Which of the following statements…
A: Recall that:amino acid sequences are written with N-terminal amino acid on the left and C-terminal…
Modify isoleucine to show the predominant forms at pH 1, 7, and 13. Isoleucine has p?ap�a values of 2.4 (carboxyl group) and 9.7 (amino group).
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- 5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stopModify methionine to show its zwitterion form. Select Draw с N 0 Templates S H More 1C || H0 C 1 с | CH₂ | CH₂ | S 1 CH3 HIN I N-H Erase Q 2 Q
- 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAGWith, Asp-Cys-Lys-Arg What are the pH buffering regions (pH range)? What is the charge at ph 4? Please explain how you find this out. Thanks!AU Py U AGGC C UGGC G GG C Jc What modified nucleoside base is indicated by the arrow? dihydrouracil pseudouracil -ACC.
- How do you seal sequence 2 (from 5' end) to the 3' end of the sequence 1 in vitro condition? Design a splint oligomer and write the all-possible content(s) needed for reaction to occur. Sequence 1: 5'ACTGTCGATGCTAGCTTGATCCAAGTATTGCTAGACAGAATTGACATATAGGCGATGCTAGT3' Sequence 2: 5'ATCGCTAGGATCGCTAGATTTAAGTCGCTGATCGGCTAGATATAACAGGTCCTGAATCGCTA3'= A different Fab fragment binds to lysozyme with a dissociation constant of Ka 10-6 M. A 1 nM (10-9 M) solution of lysozyme is treated with increasing concentrations of this Fab fragment. At what concentration of added Fab will half of the lysozyme be bound to this Fab? [F] = ab MDetermine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the fragments generated with each treatment. Determine the original sequence for both fragmentations (reduerde that they must be equal in the order of amino acids) Quimotripsina 1. Leu-His-Lys-Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly-Pro-Ser 1. Gln-Gln-Ala-Gln-His-Leu-Arg-Ala-Cys-Gln-Gln-Trp 2. Arg-lle-Pro-Lys-Cys-Arg-Lys-Phe Trypsin 1. Arg 2. Ala-Cys-Gln-GIn-Trp-Leu-His-Lys 3. Cys-Arg 4. Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly- Pro-Ser 5. lle-Pro-Lys 6. Light 7. Phe-Gin-Gln-Ala-Gln-His-Leu-Arg
- Identify the primary sequence for the polypeptide that yields these fragments upon treatment: His-met-thr-met-ala-trp; Leu-asn-asp-phe; Val-lys obtained from chymotrypsin Leu-asn-asp-phe-his-met; Ala-trp-val-lys; Thr-met obtained from CNBR5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3′ What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU U UUC UUA UUG CUU C CUC CUA CUG U Leu GUA GUG CCU Leu CCC CCA CCG AUU ACU A AUC ACC AUA ACA AUG Met ACG lle UCC Ser UCA UCG GUU GCU G GUC Val GCC с GCA GCG Second Letter Pro Thr Ala A | Tyr UAU UAC UAA Stop UAG Stop CAU His CAC CAA Gin CAG AAU Asn AAC AAA AAG GAU GAC GAA GAG UGU Cys U UGC UGA Stop A UGG Trp G AGU AGC AGA Lys AGG | Asp Glu CGU CGC Arg CGA CGG Arg UCAG ULAG SCAG GGU GGC Gly GGA GGG с Ser U letter 3rd GA tridecapeptide yields the following fragments when partially hydrolized. Determine the sequence of amino acids in the tridecapeptidedrolyzed. Determine the sequence of the tri decapeptide. tridecapeptide à lys-arg + gly-phe-pro + phe-ser-asp-lys + pro-phe-ser + asp-lys-arg-val + gln-ala-tyr + val-trp-gln. Determine the sequence of amino acids in the tridecapeptide