Malathion is an insecticide commonly used in the horticultural industry. Many homeowners apply this chemical to their trees to rid them of infestation by aphids or other insects. Malathion is classified as an organophosphate insecticide. Exposure to malathion is very dangerous to humans and animals because it acts as an irreversible inhibitor of acetylcholinesterase. Predict what might happen to synaptic communication between cholinergic neurons if an individual or animal was poisoned with malathion, and clearly describe the mechanisms at work.

Q: What are the symptoms, cause, treatment, complications, impact of the life style of Gallstones…

A: Gallstones disorder:- it is disorder of gall bladder in which stone formed, hence it's name…

Q: (1) What does BLAST stand for? Explain the function of BLAST.

A: Information about bioinformatics is derived through computer analyses of biological data. In…

Q: hierarchical/levels of organization in ecology.

A: Introduction  Ecology is the scientific study of the distribution and abundance of organisms, as…

Q: Identify a false statement moist environment promotes bacteria colonization within our body O…

A: Bacteria Bacteria are classified under the kingdom Monera , they are prokaryotic cells. In bacteria,…

Q: What are some other prezygotic reproductive barriers besides a mating dance?

A: Reproductive isolation is necessary for organisms to separate from their shared ancestors and propel…

Q: In his infamous, genetic code-cracking experiment, what did Nirenberg use as a source of translation…

A: Since you have asked multiple questions, we will solve the first question for you. If you want ant…

Q: 3. For every 3 turns of the Calvin Cycle, 1 molecule of G3P (Glyceraldehyde-3-Phosphate) is…

A: Photosynthesis is a process by which green plants prepare their food in the form of glucose by using…

Q: Which is made in the reproductive organs?

A: Reproduction is the process by which new individual organisms are produced. Organisms of the same…

Q: Briefly explain how protein breaks down in the body How do enzymes affect the proteins that we ate?…

A: Enzyme The protein molecules which act as catalyst in biological reactions.

Q: In which portions of the upright test tube do Paramecium tend to aggregate. Explain. What is…

A: Single-celled protists known as paramecium or paramecia can be found in watery areas in the wild.…

Q: Your cynical best friend says, “Who cares if one out of every two species of amphibian goes extinct?…

A: Introduction :  The variety of life forms is referred to as biodiversity. It is a term that is…

Q: In 1985, a researcher conducted a study of mortality among a cohort of shipyard workers who were…

A: A research study involves re-studying and analysing the previous results and conclusions to derive…

Q: What would most likely happen if you experimentally delete the signal sequence of a prospective…

A: mRNA and the ribosome work together to generate a specific protein during protein translation.…

Q: Antonie van Leeuwenhoek was the first person to use a microscope and describe tiny animalcules. What…

A: Introduction :  A microorganism is an organism too small to be seen by human naked eyes.…

Q: How might we use DNA sequence similarities together with biogeography as evidence for evolution?

A: Evolution is the gradual change in the inherited traits of living organisms over many generations.…

Q: Compare and contrast the structure and function on ribosomes and proteasomes.

A: Ribosome  * Ribosomes are one of the cell organelles present in the cell * In eukaryotes and…

Q: What is the role of the mannose-6-phosphate (M6P) group? • What happens when M6P cannot be…

A: Mannose-6-phosphate is a molecule bound by lectin in the immune system. M6P is converted to fructose…

Q: What happens if plasma membrane fails to maintain optimal fluidity? • Describe structure/function of…

A: * plasma membrane is the envelope like structure that surrounds the cell and its organelles . *It is…

Q: If you are trying to set up a PCR with a total volume of 40uL and you have access to a stock…

A: Inroduction DNA replication occurs in our body. But PCR or polymerase chain reaction  is a…

Q: Define and give an example of coevolution.

A: Evolution is the process of change in heritable traits of biological organisms over successive…

Q: == What was the order of the pigments on the chromatography paper from the bottom up? Postlab 6.13…

A: The chromatographic technique is based on the interaction of solute and solvent molecules. By the…

Q: Answer it. In Seminal Fluid Analysis, what are aspects of semen that are assessed microscopically?

A: Sperm  The male gamete that is motile and fertilize female gamete.

Q: Why do vancomycin-resistant bacteria have a higher frequency in the population after treatment with…

A: Vancomycin is a drug that is used to treat infections caused by bacteria. It works by killing the…

Q: Explain Darwin's Theory of Natural Selection using these terms: exponential rate of increase,…

A: Charles Darwin, the author of 'Origin of Species was a born naturalist. He is known for the most…

Q: In the same cross as question #1, what fraction of the offspring will have their father's genotype…

A: Genotype  The genetic makeup of a individual is known as genotype.

Q: Which of the following statements are correct about cytoplasmic signaling in cancer cells? Multiple…

A: Metastasis is a significant cause of mortality worldwide. Cancer cells acquire genetic alterations…

Q: For some kinds of experiments, biologists use isolated cells grown in culture. Cells differ…

A: Doubling time is the time taken for cells to complete one cell division. It varies for each…

Q: Rehpogs are mythical creatures. They are small and not very smart. Rehpogs live on the ground in a…

A: Introduction Inheritance patterns are of different type’s   Mendelian inheritance, incomplete…

Q: A male fruit fly, heterozygous for both vestigial wings and ebony body, is crossed with a female…

A: Introduction An expression of a trait, which could be morphological, behavioral, molecular, etc., is…

Q: Do peptide bonds get protonated or deprotonated? Explain

A: Peptides are short chains of amino acids that are linked by peptide bonds. Chains of less than 20…

Q: Assuming all the genes assort independently, what proportion of the offspring from a cross between…

A:

Q: Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.

A: The process of speciation is how populations develop into separate species. When populations are…

Q: Which species is/are allopatric with E. lucunter?

A: The mechanism through which populations develop into different species is known as speciation. In…

Q: Which eukaryotic initiation factor (elF) brings the initiator tRNA to the ribosome? elF1 1 O elF2…

A: The process by which the mRNA codes for a particular protein is known as Translation.

Q: Do you think one species’ adapting over time to feed specifically and extremely successfully on…

A: Coevolution is a multifaceted, intricate process. It can manifest in interactions among closely…

Q: Second messengers are molecules that relay signals received at receptors on the cell surface to…

A: Introduction :  The second messenger or intracellular hormonal mediator that carries information to…

Q: where would the energy this products claims to provide come from?

A: Cellular respiration is a metabolic pathway by which the consumed complex sugars molecules are…

Q: Should similarities in the DNA sequences of genes be considered evolutionary homology? Explain.

A: According to their shared evolutionary parent, distinct species of animals with similar structure,…

Q: Which of the following is a primary function of the active site of an enzyme?   a. It binds…

A: Enzymes are proteins that help speed up metabolism, or the chemical reactions in our bodies. They…

Q: Based on these sequences. Remove codons 24 to 66, inclusive. Sequence A…

A: The enzyme complex responsible for this excision is known as splicesome. Splicesomes are complicated…

Q: Many obese patients are part of a family in which all, or the majority, of it's members are obese.…

A: Genes are information/ trait encoding units present in the genome or DNA of organisms. These genes…

Q: 4 lines of evidence for evolution are presented (population, gene pool, allele…

A: Population:  According to the biological species concept "a group of potentially interbreeding…

Q: In humans, when iodine levels are adequate, abnormally high TSH secretion would likely result in…

A: Hormones are chemical substances that are secreted by various glands inside the body upon receiving…

Q: A scientist investigating the genome of two related individuals observes a difference of a few…

A: Mutation  Change in the sequence of DNA is known as mutation.

Q: C -B اصليين انا A

A: Some cells, such as unicellular bacteria and protozoa, are complete creatures; others, such as…

Q: Why are the protein receptors on the egg cell particularly important among aquatic animals that use…

A: Fertilization is the process in which intermingling of male and female gamete fuse together and form…

Q: Consider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for…

A: Explanation: A plasmid is a circular piece of DNA that will be utilized in the process of inserting…

Q: Suggested Study Questions: 1. What is a karyotype? 2. Explain why staining of chromosomes is…

A: Genetics involves inheritance, characteristics, DNA, genes, proteins, and chromosomes. Everyone…

Q: genotype cannot be determined QUESTION 2 Suppose that extra fingers and toes are caused by a…

A: Introduction: Any one of two or more genes that may alternately appear at a specific location…

Q: The girl is focusing a slide and she is turning the coarse adjustment knob up toward the slide.  A.…

A: An optical microscope has the following parts:- A stage for placing the slide A set of objective…