Q: Wilson's disease is an inherited disorder in which there is too much copper in the body's tissue. It…
A: Introduction : The study of a specific trait that is passed down from one generation to the next is…
Q: Ribosomal prote 4. Eukaryotic ribosomes have some similarities to prokaryotic ribosomes, but they…
A: Prokaryotic cell do not have membrane bound organelles however eukaryotic cells do have. Prokaryotic…
Q: ¹C2²2S + E Sk3,0 where S is a T-cell of a particular variety, E is the corresponding (free, i.e.…
A: T cell, also called T lymphocyte, type of leukocyte (white blood cell) that is an essential part of…
Q: D An epistatic gene A is a gene that is A at a different location than gene B and that is capable of…
A: Gene is a sequence of nucleotides in a DNA. It encodes a particular polypeptide which expresses in…
Q: Which of the following describes the most likely outcome of a mutation that causes a sin- gle amino…
A: Mutation signifies the change in the nucleotide of the DNA/gene sequence. This change in the gene…
Q: Use the forkline method to derive the gametic ratio of cross AabbDD x AABbDd. The cross are…
A: The fork line method can be used to determine the probability of gametes or genotypes. This is done…
Q: Why is the study of how the different amounts of carbon change bacteria growth an important study?
A: Study of carbon change in bacterial growth is helpful because it can help us to understand various…
Q: Indicate if each chromosomal abnormality will likely have a phenotypic consequence An individual…
A: Chromosomes are the structures that are condensed DNA threads, they carry genetic information of…
Q: Does everyone smell the same way? Give reasons why they might, and reasons why they might not.
A: Smell is a sense which is perceived by olfactory receptors present in the nasal epithelium of nasal…
Q: In order to see the effect the change in humidity had on the transpiration rate, what would be a…
A: Humidity and Transpiration in plants : Humidity and transpiration in plants are inversely…
Q: Review the summary of a published scientific study below: Patients with multiple sclerosis…
A: So, there are seven scientific methods for research:- 1. Making an observation. 2. Question and…
Q: Active transport moves molecules OA. toward the region of lower concentration of the molecule. OB.…
A: Active transport is defined as a type of cellular transport in which molecules tend to move from an…
Q: what is the difference between a ligand and a domain? I understand they both attach with proteins…
A: Ligand Domain A ligand is a chemical substance that are released in order to induce or transmit a…
Q: Which of the following hormones promotes glycogenesis? growth hormone, Hydrocortisone, Insulin, or…
A: Glycogenesis can be defined as the process through which glycogen is synthesised and glucose…
Q: describe the yeast specimens grown on PDA using Dalmau Plate Method incubated at 35°C for 48 hours…
A: S. cerevisiae S. cerevisiae also known as yeast it belongs to the kingdom fungi.
Q: 100 cfu/mL
A: CFU - The full form of this is the number of Colony Forming Units.
Q: When a pseudoscorpion hitches a ride on a large arthropod, what does the larger arthropod gain from…
A: This is a type of commensal interaction that is known as phoresy. Commensalism is an interaction in…
Q: The following is the location of the cell membrane proteins: O a. Some only face the extracellular…
A: Cell membrane The living semi permeable membrane that is selectively permeable and allow both…
Q: Which of the following most accurately reflects current understanding of phylogenetic relationships…
A: A phylogenetic relationship is a study of the relationship among organisms of a species or a…
Q: need to prepare a standard calibration curve for gamma globulin. absorbances on Y and mg of standard…
A: To obtain the values, first average the data for individual points and then subtract the blank's…
Q: Which statement correctly explains the formation of hydrogen bonds? A B с D The partially negative…
A: The correct option is: The partially positive oxygen atom on one water molecule is attracted to…
Q: You work in a gynecological office, and your office has been asked to participate in a women’s…
A: A malignant tumor of the cervix region, the lower part of the uterus. A malignant tumor of the…
Q: learn.edgenuity.com/player/ SC5181 A Mark this and return < : A lichen is an organism that is…
A: Introduction :- Obligate mutualism is a species-to-species connection in which each are totally…
Q: r19.core.learn.edgenuity.com/player/ al Science - SC5181 A 12 14 Unmark this question 16 17 18 19 20…
A: Introduction :- Resources are frequently scarce in an environment, and numerous species may compete…
Q: When an electric force is applied to a lipid, the electron clouds stretch and d but the electrons do…
A: Electric fields can induce lateral reorganization of lipids in fluid bilayer membranes. Biological…
Q: What bone articulates to the Pelvic Girdle? Femur Describe how the ball and socket joints for the…
A: Introduction The bottom part of the trunk is called the pelvis. The pelvic region is the area…
Q: How much ATP is produced from one glucose molecule BEFORE Oxidative Phosphorylation? a. two b. four…
A: Introduction: In the presence of oxygen, glucose molecules are broken down into energy during…
Q: What is a major problem with morphologically-based analysis of whale placement in a phylogenetic…
A: Using anatomical features, morphological phylogeny infers evolutionary trees. Node: A branching…
Q: Consider the true diploid plant cell (2n=4) below. The paternally derived blue chromosomes are of…
A: Cell division is a phenomenon in which parent cell undergo splitting process and give rise to novel…
Q: 1. Living vertebrates share a set of derived characters that distinguish them from other How does…
A: Homeobox group of genes are important transcription factors that are essential for embryonic…
Q: In a gel electropherosis, Glutamate and valine created a double bond. How is that possible?
A: Proteins compose the body's fundamental structural constituents and are found in every cell and…
Q: What type of epithelium lines the gastro-intestinal tract? O Transitional Simple columnar O…
A: Epithelium tissue consist of cells that lines body surface and glands.In epithelium tissues,cells…
Q: major problem with morphologically based analysi
A: As the name indicates, the morphology-based analysis only considers the visible characteristics of…
Q: ce-SCS x 19.core.learn.edgenuity.com/player/ Science-SC5181 A ↑ O All biomes will show decreases in…
A: A biome is an area classified according to the species that live in that location. Temperature…
Q: D In the following DNA strand, find the position of the start codon, stop codon and determine the…
A: The given DNA strand - GGTACTTTATACCCTGATACATTTGTGGGG Corresponding mRNA strand -…
Q: where do monomers travel next after leaving the enterocyte in a) protein digestion and B) lipid…
A: Introduction A monomer is a molecule from a group of primarily organic chemicals that can combine…
Q: when a woman is injected with an egg fertilized in vitro, the probability of its implanting is 20…
A: Implantation The process of attachment of embryo with uterus is known as implantation.
Q: You have two solutions that are isosmotic to each other and to a cell. However, when testing for…
A: Tonicity can be explain as the measure of relative concentration of solute particles present both…
Q: write summary on Marine biomes
A: Large biological zones that occur on the Earth's surface are known as biomes. They are, in reality,…
Q: in the blanks Bacteria inside termites are ___________ when they live on the outside of protists…
A: Termites are capable of digesting cellulose present in the wood. Cellulose can be digested by the…
Q: 8) PCR (polymerase chain reaction) 9) plasmid A. Creates millions of copies of DNA within hours B.…
A: PCR amplifies a specific region of a DNA strand (the DNA target). Most PCR methods amplify DNA…
Q: A B H₂C The structural formula of erucic acid and behenic acid с H₂C D erucic acid behenic acid…
A: Saturated fatty acids are the fatty acids which donot have any double bond in their chain ,whereas…
Q: 8. A 60 kg individual needs to work at a MET level of 8 to reach her target heart rate. If the…
A: The grading and the intensity for the question is solved below in the pic :-
Q: D NO D ВО 70- 60 50 40 30 20 10- D 0 5 graph shows the growth of the P caudatum population when it…
A: Correct answer is "C" Competition occurs when resources are limited in a habitat than different…
Q: Describe and discuss the characteristics of cancer cells. (keep it short please 4-5 sentence)
A: Introduction :- To produce new tumours, cancer cells may splinter off from the primary tumour and…
Q: Why do men typically have a greater lung capacity than women of equal size? a. They have larger…
A: Lungs: These are the organs in the body which are involved in gaseous exchange and supply of oxygen…
Q: 5) The immunoblot shows probing of samples taken from a time course after treatment with the…
A: MG-132 is a potent proteasome and calpain inhibitor. Research studies have shown that MG-132…
Q: erything about treacher Collins Syndrome disorder. T
A: Gene is the hereditary material that stores and transfers information from one generation to other.…
Q: Which of the following best describes the principle demonstrated in the figure below? CH.OH H H Н Н…
A: Every living creature goes through a primary mechanism known as metabolism. Metabolism happens…
Q: Question 10 A diagram shows cellular activity across a cell membrane. Glucose in high concentrations…
A: The plasma membrane of the cell is a selective barrier that controls the movement of different…
Step by step
Solved in 2 steps
- che World Mona L A Leonardo da Vinci Museum - Flo x dSequenceViewer/14003927urlahttps%3A%2F%2F43160dd0-1a11-43d1-b28d-96e9e2abb6d2.sequences.api.brightspace.com2F1400392%2Factivity2217 1.07 Quiz: Experimentation UIZ: Experimentation Kate gathered three boxes of the same size made of different materials glass, clear plastic, and aluminum painted black She placed them on a window sill in the sun for an hour and then measured the warmth of the air in each box In this experiment, what is the warmth of the air? O an independent variable O a control O a constant O a dependent variable 2 3 45 NextThis descriptor refers to the number of alignments expected to match the sequence you have by chance. E-value Query cover Accession number Ident Maximum score and Total scoreExplain how the different “-omics” involved with the three major parts of the central dogma can be used to study this new species. What are molecular techniques/tools (sequencers) that can be used to study each of these? How would you sequence the genome efficiently (i.e., lowest amount of time and money)?
- This descriptor refers to the highest alignment score of all matched sequences to the sequence placed in the BLASTn search. Query cover Maximum score and Total score E-value Ident Accession numberacconline.austincc.edu/ultra/courses/_891351_1/cl/outline O gel electrophoresis O PCR O genomic library DNA microarray A patient is suspected of having a certain type of cancer that involves several genes. Doctors want to determine whether this patient is expressing these cancer genes and to what leve each gene is being expressed. What technique may be used? O molecular cloning O CRISPR gene editing 5 genetic recombination that occurs naturally (think horizontal gene transfer, meioșis, fertilization, or mutations). Ar : Y EV АУ ΩΘΙ 用く X A MacBook Air & 8 88 Q V Ix % 0 8A EXE D B 图 Q 用图 5 d Show All † 19 EHR ImmunizaDetermine the RIGHT order of a standard molecular biology workflow for species identification and classification. 1 2 3 4 5 6 7 DNA extraction Primer design DNA quantification (AGE and UV-Vis Spectrophotometry) Genomic/DNA sequencing DNA sequence processing and analysis PCR DNA quantification (Confirmation of PCR product via AGE)
- Which of the following is not a reason we often perform metagenomics studies by doing PCR using long degenerate primers for the 16S gene? Eliminates issue of having to randomly fragment DNA for sequencing (which can sometimes be tricky to optimize) All microorganisms have a 16S gene It is taxonomically informative and allows you to identify taxa using a database You can estimate relative taxa abundance by relative read abundance, avoiding genome size bias. You can make a phylogeny allowing you to do diversity analyses 16S has conserved regions and the primers used allow for some sequence variation, so we can amplify the region from different taxa efficiently using PCRBOTTOM The sequence depicted on the gel is 5'-GTGATGTAG-3' The sequence depicted on the gel is 3'- GTGATGTAG -5' The sequence shown on the gel is the sequence of the template strand of the reaction The sequence shown on the gel is complementary to the template strand of the reaction The template strand of the reaction is antiparallel to the sequence shown on the gel The largest fragment shown on the gel is closest to the top The largest fragment shown on the gel is closest to the bottom Each of the fragments shown on the gel have a primer incorporated at their 5' end Each of the fragments shown on the gel have a primer incorporated at their 3' end The number of nucleotides in the shortest band on the gel is 21 The number of nucleotides in the longest band on the gel is 21 ick Save and Submit to save and submit. Cick Save All Answers to save all answers.1. What is the difference between an iterated blast (psi-blast) search and a simple blastsearch?2. Arslan sequenced a gene in lab how he will know about the gene either it is noveldiscovery or gene is already present in the database?3. Ruwaifa want to compares a nucleotide query sequence what option he will opt inBLAST and why?4. Uzair has two protein sequences, he want to check their similarities what he will do? What results are expected
- S Spani X S Ceran X S Envirc X S IXL To X D IXI. -I X Po Envirc X E Copy X S Feder. X w Aline X le.com/document/d/1V09u32BD_tZsEDgYvSi2fvdiitAhSvcuLPWDLHK2QsY/edit rer | Log in 6 Electoral Process_ac.. Da. IXL - Lines, line seg.. y Guide * D O Format Tools Add-ons Help Last edit was 2 minutes ago BIUA 三, 三|三▼=▼三E Normal text Arial 11 1 I 2 3 4 5 6 6. In contrast to nonrenewable, renewable energy sources produce little or no pollution or hazardous wastes, pose few risks to public safety, and are entirely domestic resources. Explain why you agree or disagree with this statement. 8. Describe what coal ash is and the environmental and poison problems that come with storing coal ash. 9. Why is it important not to waste energy? As a citizen, how do you conserve energy? 立Humans have manipulated traits in organisms by selective breeding. With new technologies, humans have recently been able to edit genes that are inherited. Explain one benefit of gene editing. Edit View Insert Format Tools Table 12pt v Paragraph v BIUA ev T?v :1. Definitions and brief statements 1. DNA Data Bank of Japan 2. MeSH Database 3. Please describe the 3 steps and temperature that are cycled during a PCR reaction. 4. What are global alignment and local alignment and their algorithms? ( 5. ProtScale