**NOTE: Choose the correct answer Lichens are formed by an association between:fungi and plantsO algae and plantsO protists and algaealgae and fungi Life on Earth is believed to have begun in the oceans. The first organisms to successfully move from the water to grow on land were probably:O plantsO bacteriafungianimals

Introduction Ecology:- It is the study of the relationship between living organisms and their…

Answered: Lichens are formed by an association…

Science

Biology

Lichens are formed by an association between: fungi and plants O algae and plants O protists and algae algae and fungi

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter23: Fungi

Section: Chapter Questions

Problem 3SQ

See similar textbooks

Related questions

Q: To explain: Whether humans are dominant species or key ştone species.

A: A species is a group of organisms with genetic similarities, the ability to interbreed, and thus the…

Q: Give the PLOIDY of the following (ex: haploid, diploid, etc…) 1. oospore 2. prothallus 3. androcyte…

A: Ploidy can be defined as a total number of sets of chromosomed present in a nucleus of a cell.…

Q: Which one of the following sequences is most likely to cause a ribosome to release a mRNA strand?…

A: A ribosome is an inter - cellular structure made up of both RNA and protein that provides as the…

Q: To determine: How chloroplasts generate a larger proton gradient across the thylakoid membrane than…

A: For living functions, that is when it comes on to the term that the cell eukaryotic cells require a…

Q: Describe the proximity in time, similarity in timbre, pitch and good continuation? How are these…

A: Sound is defined as the vibrations that travel through the air or another type of medium as an…

Q: To determine: The trophic levels and the way in which they are related to ecological pyramids.

A: The Sun provides energy to the Earth in the form of light. The organisms efficiently exploit the…

Q: To determine: A defining characteristic of the innate immunity.

A: The ability to remember is the most noticeable feature of the immune system. Memory is an important…

Q: QUESTION 9 For the mating below, indicate whether nondisjunction occurred in the mother, father,…

A: Introduction Genetic analysis refers to the general process of studying and investigating genetics…

Q: To determine: How chloroplasts generate a larger proton gradient across the thylakoid membrane than…

A: The photochemical and electron transport reactions of photosynthesis process occur at the thylakoid…

Q: Compare the characters of lemuroidea , Tarsioidea and Arthropoidea. Pls make a chart or table so I…

A: Lemuroidea , Tarsioidea and Arthropoidea are the 3 suborders of order primates, and subclass theria…

Q: Consider the similarities and differences in the cell cycles (mitosis and meiosis) of plants and…

A: Mitosis and Meiosis similarity 1. Both occur during cell reproduction. 2. Both occur in stages.…

Q: How hormones affect different classes of vertebrate?

A: Hormones are chemical substances that act like messenger molecules in the body.

Q: cance of color blindness in humans is due to a recessive gene located on the X chromosome X linked).…

A: Mother × father XXc XcY Progeny - X Xc Xc XXc…

Q: Multicellular organisms exhibit a hierarchy of cellular organization. The diagram below shows four…

A: On a scale of small to enormous, living beings are highly organized and arranged in a hierarchy. As…

Q: 1. Along the coast of Vancouver Island in British Columbia, Canada consists of intertidal zones…

A: Introduction The term "population" usually refers to the number of people living in a specific…

Q: Cotransport systems of the internal epithelial cells include the _____ in the intestine facing…

A: Cotransport is the transport of one molecule across the plasma membrane of cell against the…

Q: Assume for a moment that crossing-over did not occur. Would you agree that you received half of your…

A: Crossing over is a phenomenon that develops in novel gene combinations by transferring and swapping…

Q: How much of 9XTBE (in ml) and how much water (in L) do you need to prepare 2 L of 1XTBE? I need I…

A: Given, 9xTBE and water. We need, 2L of 1xTBE solution. We will use the formula, M1V1 = M2V2 M1 and…

Q: You are investigating the loss of activity of a particular enzyme in a mutamt bacterium. You…

A: The activity of an enzyme is micromoles of product formed per minute. The enzyme interacts with to…

Q: explain the concepts of inflammation

Q: Which of the following are characteristics of minerals? Select all answers that apply. Inorganic Not…

A: Introduction Minerals are necessary for your frame's well-being. Minerals are used by your body…

Q: B. Cholesterol mainly occurs in the cell walls of mammalian cells

Q: 1. Summarize the blood level data with a frequency distribution. 2. Calculate the arithmetic mean.…

A: There are few important points to remember : Mean : It is defined as sum by number of its value .…

Q: The ability to taste the compound PTC is controlled by a dominant allele T, while individuals…

A: Polythiocarbamide ( PTC ) is bitter chemical compound . Sone individual able to taste it while other…

Q: 3.' To determine the effect of the bicoid gene, scientists injected bicoid mRNA into the posterior…

A: Introduction Bicoid is a morphogen that regulates the expression of genes in the anterior of a…

Q: Barr bodies inactivate Xic on autosomes. O are formed in female somatic cells O are formed in female…

A: Barr bodies is an inactivated X-chromosome. It is present in a cell that contains more than one…

Q: In photosynthesis which percentage of oxygen produced is used for cellular respiration in the plant?…

A: The oxygen that is released in the photosynthesis is used in the cellular respiration by the plants.…

Q: In the fruit fly, dumpy wings (d) and purple eyes (p) are encoded by mutant alleles that are…

A: The two genes are involved in this case. The wings and eye encoding genes are involved here. The…

Q: Define the following terms: a. Chermolithoheterotroph b. Microaerophile c. Chermoorganoheterotroph…

A: The living world, as we all know it, can predominantly be divided into - Plants and Animals. Apart…

Q: Are humans a land-sharer Or land-sparer? Why?

A: Land-sharing systems and Land-sparing systems are two contrasting approaches to sustainable living.

Q: How large (as a proportion of body size) should the testes of chimpanzee males be relative to…

A: The testicles are responsible for making testosterone, the essential male sex hormone, and for sperm…

Q: B 1. Name the region of the hair labeled A. 2. Name the structure labeled B. 3. Name the specific…

A: Hair Hair is a thread like strand grow on the skin of the mammals and some other animals.

Q: Rapidly dividing cells such as bone marrow, skin, intestinal mucosa, and cancer cells need DNA…

A: Cancer is a disease defined by the uncontrolled development of a group of abnormal cells that can…

Q: A defining characteristic of sympatric speciation is a.The appearance of new species in the midst…

A: In presence of ancestors a new species evolve and both remain in the same habitat/same geographical…

Q: First food chain Second food chain Trophic level Organism Trophic level Organism

A: First food chain Trophic level organism Level 1 (Producer) Diatoms and other phytoplankton.…

Q: It is necessary to develop a string matching method that may be used to compare two or more…

A: To determine patterns over sequences and to determine different matching pattern we use string…

Q: The O-antigen is part of the bacterium's which is found in the outer membrane of some bacterial cell…

A: Introduction Antigen:- It is any substance that causes the body to make an immune response against…

Q: A/An ___ is one of the 13 linear polymers of tubulin subunits that forms a microtubule.

A: The cytoskeleton is made up primarily of microtubules. They are found in all eukaryotic cells and…

Q: Calcitonin is enzyme that functions to reduce blood calcium levels True O False CK may be derived…

A: Storage lipids, also known as triacylglycerols, membrane lipids, which include glycerophospholipids…

Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…

A: DNA contains the genetic information about the characteristics features of te organism present in…

Q: 6. Which of the following statements best explains why cancer is so difficult to cure? O A. Each…

A: Cancer is a condition in which some cells in the body grow out of control and spread to other parts…

Q: To brachiate is to O move around suspended from branches like a Siamang to leap from tree to tree…

A: Evolution can be defined as the unrolling of nature that brings about an orderly change from one…

Q: QUESTION 12 Consanguinity most often leads to an increase in prevalence (comapred to the general…

A: autosomal recessive disorder.

Q: Match the pieces of the negative feedback arc that regulated the increase in stroke volume seen…

A: Answer given in step 2. Thank you.

Q: how an angiotensin converting enzyme inhibitor ACE such as captopril would effective as an…

A: Anti hypertensive means the drug causes the reduction in blood pressure. Normal blood pressure is…

Q: Question 4 (1 point) Metabolism refers to burning food during physical activity like running.…

A: The true answer is... All of these (e)

Q: 417 ash Course Biology #7 - ATP & Respiration 1. Cellular respiration is how we derive energy from…

A: Respiration is the biochemical process in which the cells of an organism obtain energy by combining…

Q: A population has 700 individuals, 85 of genotype AA, 320 of genotype Aa and 295 of genotype aa. What…

A: The Hardy-Weinberg equation is expressed as: p2 + 2pq + q2 = 1 p is the frequency of the "A" allele…

Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…

Q: The following graph depicts the relationship between the mean flower depth of Zaluzianskya…

A: Introduction Evolution is the process of a species' features changing over numerous generations…

Question

**NOTE: Choose the correct answer

Lichens are formed by an association between:
fungi and plants
O algae and plants
O protists and algae
algae and fungi

Life on Earth is believed to have begun in the oceans. The first organisms to successfully move from the water to grow on land were probably:
O plants
O bacteria
fungi
animals

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Fruiting bodies are absent in which of the given pairs of classes of fungi? Phycomycetes and Ascomycetes Ascomycetes and Basidiomycetes Basidiomycetes and Deuteromycetes Phycomycetes and Deuteromycetes
Lichens are an example of a symbiotic relationship between and Phaeophyta, Oomycota Chlorophyta, Oomycota O Phaeophyta, Fungi O Chlorphyta, Fungi
Lichens are not in a mutualistic relationship with ascomycetes as some scientists beleive but are in a mutualistic relationship with cyanobacterium or algae. true or false?
Which of the following is not a structural characteristic of fungi? Hyphae Spores Roots O Mycelium
Describe two ways in which fungal spores arise. Septatae vs aseptatae hyphae
During the life cycle of fungi, karyogamy: * O results by meiosis which produces zygote occurs in both sexual and asexual reproduction O occurs in asexual reproduction occurs in sexual reproduction results from spores germination
Which of the following statements is FALSE about fungi? O A Fungi can be either heterotrophic or autotrophic. O B Septa are divisions between fungal cells with small pores that allow cytoplasm to flow between the cells. O C Fungal cells walls contain chitin, which is the same material found insect exoskeletons. D The fungi and the choanoflagellates are part of a group called the Opisthokonts. O E All fungi are part of a single monophyletic group.
The hyphae of fungi provide these advantages (select all that apply). O Provide large surface area to volume ratio Allow for better searching to find food The mycelium is not sensitive to dry conditions They can withstand cold and hot temperatures in certain species The mycelium can be as large as 3.4 miles in one individual O O
FUNGI USED TO BE CLASSIFIED IN THE SAME KINGDOM AS PLANTS. IN TIME, SCIENTIST OBSERVED A KEY CHARACTERISTICS THAT REQUIRED RECLASSIFICATION. WHAT WAS THAT CHARACTERISTIC? Required to answer. Multiple choice. FUNGI ARE HETEROTROPHIC FUNGI REPRODUCE SEXUALLY AND SEXUALLY FUNGI ARE EKARYOTIC FUNGI ARE MULTICELLULAR
Which of the following is NOT a reason why fungi can grow so quickly? Group of answer choices external digestion of food particles hyphae with incomplete or no cells walls between cells a huge number of hyphae a very small SA: V ratio very thin hyphae
You discover a fungi that has the ability to penetrate its host's cell wall. Which fungal group would this species most likely belong? O lichens O arbuscular mycorrhizal O endophytes O ectomycorrhizal fungi MacBook Pro ☆ G Search or type URL & #3 3 4 5 8 TE T. Y R
The main growth form of fungi is made up of Select one: O a. hyphae O b. gametangia O c. fruiting bodies O d. sporangia O e. molds