Learning Task 2: In the space below, attach three to five examples of household items/goods(wrapper or the piece of packaging) that are products of biotechnology and briefly explain how so.
Q: Explain how biotechnology utilized microorganisms like bacteria, yeasts, fungi, molds, etc. to…
A: Microbes are regarded as superior biological materials for biotechnology because of their wide range…
Q: After learning about cellular respiration and conducting many experiments: How does what you have…
A: A cell is the basic and functional unit of a living organism. The cells require energy so as to…
Q: xplain the following areas about ((X-ray machine)) achine? 1. What are the components of the 2.…
A: X ray machine is a machine which involve X ray that is used for the purpose of imaging. It is also…
Q: n your point of view as a senior high school STEM student, are humans still volving? Provide…
A: Evolution means a change in the population. Evolution is the change in the characteristics of a…
Q: Stem cells: How do you think stem cells could be used to treat diseases?
A: Cells are the basic unit of life. Stem cells are totipotent cells, which can produce different cell…
Q: To test whether you learned something from this module, answer briefly the following questions…
A: Dyes are used to impart colors to substances. Dyes are of different types which are : (i) Pigment…
Q: Q.15. What are the different types of biotechnology?
A: Because of the broad scope of biotechnology, it has become necessary to categorise biotech products…
Q: How to properly handle a Microscope? Explain.
A: Microscopes can be described as the devices which are used to magnify the small objects, allowing…
Q: Discuss the importance of Stem Cells. How does the scientists harvest the stem cells in our body?…
A: Introduction Stem Cells Are Cells That Have The Ability To Differentiate Into A Variety Of Various…
Q: Understand the parts of a cell, how cells communicate, and the process of DNA mRNA protein and the…
A: Cells communicate with one another by secreting chemical messages such as neurotransmitters,…
Q: VISUAL SKILLS Consider the microarray in Figure 20.12.If a sample from normal tissue is labeled with…
A: A microarray is a tool in the laboratory used to detect thousands of gene expression at the same…
Q: How you apply your knowledge on tissue culture in biotechnology?
A: The science of growing of plants, tissues or organs from the mother plant under the in-vitro…
Q: Insights with the stem cell 10 sentences.
A: Introduction: Stem cells are found in the very early stage of embryo and these are undifferentiated…
Q: 8-12 years old child's eye retina area is yellow. Which methodology do you follow to develop a…
A: Our eyes appears as orange due to the presence of a layer of pigmented cells inside the retina. This…
Q: why is it possible to easily collect cells by gently scraping the inside of your cheek?
A: Cells, which are the basic building blocks of all living species, are the basic building blocks of…
Q: Analysis: Write your answers on the space provided. 1. How does the letter “e” as seen through the…
A: A microscope is a piece of equipment that enlarges an item. The image of an item is enlarged in the…
Q: What orchestrates cell differentiation? Why is cell differentiation important? What does it lead to?…
A: Introduction :- Unspecialized cells become specialised through the process of differentiation to…
Q: elivery/start/5362404321?action3=D Biomolecules, Cell Theory, and Microscopes HW Q Which microscope…
A: Compound microscope Microscope is an instrument that is absolutely essential for the…
Q: Please help 33. Tissue engineering is the ability to grow cells in a laboratory. These cells are…
A: Introduction- Due to trauma or any other causes, body n=may lose the tissue and the human body's…
Q: Describe the 4 different types of stem cells. (Totipotent, pluripotent, multipotent, IPS)
A: Stem cells are partially differentiated or completely undifferentiated cells which have the…
Q: nursing and molecular biology?asap
A: Relationship between Nursing and Molecular biology.
Q: Differntiate between cytotaxonomy and chemotaxonomy?
A: Scientific classification is the study of naming, depicting, and grouping creatures and incorporates…
Q: 1. Match: Read about each microscope part. Match the description to the part on the diagram. B…
A: Microscope is an instrument to see the small sized object which can't be seen by naked microscope.…
Q: Questions - Introduction 1. What kinds of materials obtained from a crime scene might contain DNA?…
A: As per the honour code, we are entitled to do only three questions at a time. Therefore I am…
Q: topic: cheek cells 1. why are stains such as methylene blue used when observing cells under the…
A: Methylene blue helps to stain the animal's cells especially nuclei to make it more visible in the…
Q: How gene expression is controlled? (min 500 words)
A: The genes are the components of the genome that direct specific functions in the cell. Their…
Q: Stem cells: Describe some of the ways that this scientist relied on previous disciveries and…
A: Stem cells are cells which have not yet developed a special structure and function but have the…
Q: write a note on Microscope, its types and uses
A: Microscopy refers to the study of minute structures and objects by the use of an instrument called…
Q: Research 3-5 examples of GMOs. Introduce these GMOs and cite their purpose and the reasons why they…
A: A genetically modified organism (GMO) is an animal, plant, or microbe whose DNA has been altered…
Q: A DNA sequence looks like this: GAA GAG GGG GCG - Translate it to mRNA - Describe how you have…
A: The conversion of DNA to mRNA is known as translation.
Q: Q.2 Using the microscope, how would you examine a transparent specimen? (without using dyes).
A: Microscopes are the instruments that are used to view minute specimens that can not be seen by naked…
Q: Prompt Response What question might you ask? What is your hypothesis? What is your prediction? What…
A: It is a kind of mutual relationship between ants and the trees because there are some glands present…
Q: Being a prospective Biotechnologist; write about your research efforts for community in…
A: Biology is a natural science. This field of study allows the in-depth observation of the biochemical…
Q: How important it is to develop your skills in micropipetting in the field of Molecular Biology?
A: Micropipetting is a essential skill in molecular biology. It needs to be mastered successfully so…
Q: 5 of photosystems
A: Photosystems are the functional units for photosynthesis, defined by a particular pigment…
Q: Stem cell What is the debate about between President Bush and President Obama?
A: A stem cell is a cell with the unique ability to develop into specialized cell types in the body. In…
Q: Learning Insights in X-ray Filter
A: X- ray filter refers to the material situated before an X-ray to reduce the effects of a certain…
Q: What are specific proteins that might be targeted for up or down regulated adsorption when designing…
A: Introduction: Biological implantation can be simply described as the replacement of biological…
Q: %3D 2. What is the purpose of the " paraffin " in the wax bath instrument? and What are the %3D…
A: Paraffin wax is white soft solid material with low melting point and slow heat of diffusion. It…
Q: . If you are a genetic engineer, what organism do you want to manipulate? And why?
A: As per Bartleby Guidelines We have only ONE question You may repost rest of the Questions : Answer…
Q: How could stem cells be used to treat diseases?
A: Stem cells: Stem cells are specialized cells that provide new cells to the body ranging from muscle…
Q: A 45 years old patient comes to you with chief complain of neck pain along with stiffness and the…
A: Car accidents can involve the damage of many important areas of the body, and it is fatal if the…
Q: Q1 Second Performance Task in TLE Write the name of the illustration on the blank. Cut and paste…
A: Plant reproduction that involves human intervention is known as artificial vegetative propagation.…
Q: Q: Define electrophoresis. What are the different types of electrophoresis ?
A: Electrophoresis is an analysing tools used for separation of DNA, RNA or protein molecules.
Q: Explain the similarities and differences between column chromotography and gel electrophoresis?
A: Column chromatography is a process of separation of chemical components. Gel electrophoresis is the…
Q: Using the microscope Answer the following questions as you work through this exercise: 1. How is…
A: 1. letter 'e' when viewed with the naked eye would appear right side up. Normal letter 'e'. 2. Under…
Q: elp ASAP, thank you! (question is asking to pick Which 6 features are shown in the figure?)
A: The reaction given in the figure shows the enzyme catalyzed reaction with the formation and breakage…
Q: Details Please answer the following prompt: How can two cells with the exact same genome obtain…
A: Hundreds of various cell kinds, ranging from immune cells to skin cells to neurons, make up the…
Q: biotechnology: -define biotechnology -list 10 products of biotech found in our home
A: Q. Define biotechnology Q. list 10 products of biotech found in our home
Q: -hat is the 6 main basic procedure of enetic engineering?
A: Genetic engineering is the process in which the gene of interest is altered by using Recombinant DNA…
Step by step
Solved in 2 steps
- Activity 1.4: Essay.Direction: Explain your answer.Today, it is easy to make transgenic plants and animals. What are some important safety and ethical issues raised by this use of recombinant DNA technology? Explain your answer.Direction: Research and write your opinion about one or two Controversies and Ethical Issues linked with Genetic Engineering (1 paragraph max - any no. of sentences)MOST ESSENTIAL LEARNING COMPETENCY: Explain how protein is made using information from DNA. Explain how mutations may cause changes in the structure and function of a protein. PRODUCT / PERFORMANCE: Choose a syndrome or disorder caused by a mutation and research about it. Summarize the information you found in a 5-7 sentence paragraph, highlighting the cause, the type, and the effect of this mutation, and your reflection about your research.
- Subject: Cell Biology Create a SCHEMATIC DIAGRAM of a simple experiment which aims to determine if a certain cell membrane component moves in a flip-flop type manner. Sample schematic diagrams for your reference (images attached)INSTRUCTION: Answer the question properly Do not copy in Google, plagiarize checker will be used. QUESTION: Tabulate the main differences between Gram-positive and Gram-negative bacteria.Question:- Starting with data collection, describe the steps necessary to determine a 3-Dimensional structure using electron microscopy methods.
- Objective: To be able to create your own animal cell and plant cell model usingrecycled materials.Materials: Old pages of notebook old newspaper cornstarch (gawgaw)/glue old lid containers food color-3 different colors (optional), toothpick walis tingting. Procedure:1. Look for old lids (cover) of containers; you can use either circular lid orrectangular/ square lid.2. Make a paste from cornstarch (gawgaw) or you can use glue.3. Use the strips of paper and paste/glue to mold the organelles. Do so that itcan fit on the lids that you have. Let it dry. Take note of the shape of eachorganelle.4. Paint your organelles using food color (optional). Arrange the organellesaccordingly. Label your organelle using a toothpick or stick as stand for flaglets. Guide questions:1. What kind of cell were you able to make, animal or plant?2. What make it animal or plant cell?3. What are the parts that you included in your own model of the cell?4. What do you feel after you have done your…Instruction: Perform BLAST to identify the sources of the three (3) DNA sequences. Provide the information being asked. Species A: ATGTTCACCGACCGCTGATTATTCTCTACAAACCATAAAGATATTGGAACACTATATCTA CTATTCGGCGCATGAGCTGGAGTCCTAGGCACAGCCCTAAGTCTCCTTATTCGAGCAGAA CTTGGTCAACCAGGCAACCTTCTAGGTAACGATCACATCTATAATGTTATCGTCACAGCC CATGCGTTCGTAATAATTTTCTTCATAGTAATGCCTATCATAATCGGAGGCTTTGGCAACT GGCTAGTACCCTTAATAATTGGTGCCCCCGACATGGCATTCCCCCGCATAAACAACATAA GCTTCTGACTCCTTCCCCCTTCTTTCCTACTTCTGCTCGCATCCGCTATAGTAGAAGCCGG CGCAGGGACTGGTTGGACAGTCTACCCTCCCTTAGCAGGAAATTATTCCCACCCCGGAGC TTCTGTAGACCTAACCATTTTTTCCCTACACCTAGCAGGCATCTCCTCTATTCTAGGGGCC АТСААСТТСАТТАСААСААТСАТСААТАТААAАССССССGCСАТААСССААТАССАААСА ССССТТTТCGTCTGATCCGTOССТААТСАСАGCAGTCTTACTСТТСТАТСТСТСССAGTACT AGCTGCTGGAАТТАССАТАТТАТТААСAGACGTAACСТСААСАССАCСТТTTCGACCC AGCCGGAGGAGGAGATCCTATCCTATACCAACACTTATTCTGATTTTTTGGACACCCCGA AGTTTACATTCТААТССТАССАGСCTTCGGAATAAТСТСССАСАТТGTAACTTATTACTС GGAAAAAAAGAACCATTCGGATATATAGGTATAGTCTGAGCTATAATATCAATTGGTTTC…Exercise 5: Gram-stain: know steps, stains/reagents, and colors of Gm- and Gm+ after each step as well as overall process Predict cell color of Gm - and/or Gm + cells at end of erroneous process Interpret micrographs for Gm reaction
- PART C: CALCULATING THE DIAMETER OF THE FIELD OF VIEW (FOV)_ The field of view (FOV) is the circular area you can see when you look through the microscope. The diameter of the field of view is different depending on which objective lens you are using. For example, you are using the medium-power objective lens, then the area you can see is actually smaller than if you were using the low-power objective lens. Knowing The diameter of the field of view can help you estimate actual size of objects / cells seen through the microscope. When the revolving nose piece is turned to the low power objective lens, a dear plastic ruler can be placed on the microscope stage (see figure 1). Then, the coarse adjustment knob can be used to focus on the millimeter marks of the ruler making sure that one of the milimeter marks is at the left edge of the field of view (see figure 2). NOTE: Slage cip I-1000 Objects in the FOV are usually measured in micrometers (um). To convert, a FOV in mm, times it by 1000…Q about fluorescence microscope: a. Summarize the mechanisms behind how fluorescence microscope work? b. provide a brief description on how a specimen would appear under a fluorescence microscope and whether or not the specimen can be living, dead, or both c. what is the fluorescence microscope most useful in viewing (what is the key use of fluorescence microscope)?Discuss about Fluorescencemicroscopy