Jim’s jaundice is caused by the accumulation of bilirubin in his blood and tissues. What is the normal fate of bilirubin, and what role does the liver play? Explain how cirrhosis is related to Jim’s jaundice.
Q: Write short paragraphs explaining each of the following statements:(a) Natural selection chooses…
A: The process in which changes and adaption is done in the group of living organism is known as…
Q: Define 'oestrus’ and ʻmenstrual cycles.
A: These are the characteristics of the oestrus cycle and the menstrual cycle: When the female is in…
Q: 9. Two varieties of pumpkin with different weights were crossed: 5 Ib. and 29 Ib. 3/195 of the F2…
A: "Phenotype" surely refers to an observable trait. "Pheno" truly approaches "take a look at" and is…
Q: Which strand below would be the complementary strand for the sequence AAACGCTT O GGGTATCC O AAGCGTTT…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Q: Which of the following is NOT true for proto-oncogenes? O cause a gain in function O mutations are…
A: Proto-oncogenes are those genes that under normal conditions help the cell to grow but when they are…
Q: Gene therapy: a) what disease is it used for? b) what genetic defect causes the disease? c) what…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…
Q: Complete the formula for the Krebs Cycle: glucose (sugar) + carbon dioxide anergy C8 ATP)
A: In case of aerobic respiration, single molecule of glucose results in the production of 38 molecules…
Q: A young lady requested pre-marital genetic counselling because her sister had died in infancy of…
A: Gangliosidosis refers to a group of lipid storage illnesses caused by the buildup of lipids called…
Q: How does cytokinesis differ in animals and plant cells?
A: The final stage in cell division in which the cytoplasm divides at the region between two newly…
Q: Which microevolutionary force typically changes genotype frequencies without changing allele…
A: The allele frequency shows the incidence of an allele or a gene variant in a population. Genotype…
Q: Which molecules, or function groups, or complexes that may be responsible for the absorbance at 595…
A: Spectrophotometry applications are useful to measure the absorbance, reflectance, and transmission…
Q: 6. Assume height in a particular plant to be determined by 2 pairs of unlinked polygenes, each…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…
Q: Transcription occurs along a_template forming an MRNA in the _direction. * O none of the above O 5'…
A: The central dogma explain how the DNA codes for the proteins which proceed in three stages namely…
Q: Name the three phases of an action potential. Describe for each the underlying molecular basis and…
A: An action potential is defined as the difference in neuron potential that occurs as a result of…
Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…
A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…
Q: Discuss different systems of biological classification briefly.
A: In biology, classification is the process of arranging organisms, both living and extinct, into…
Q: What kind of evidence would indicate that the ability to taste PTC is inherited? Why was it…
A: 1. The ability to taste PTC shows a dominant pattern of inheritance. A single copy of a tasting…
Q: number 32
A: Linked genes The genes are said to be linked if they are tend to pass together in sperm of egg.
Q: Arthropod muscle fibers typically do not generate actionpotentials. Using your knowledge of their…
A: Introduction :- Most arthropods move by using their segmental appendages, and the exoskeleton and…
Q: Explain the single molecule of single-stranded DNA ?
A: DNA is the genetic substance which contains the genetic code of living things. The terms DNA and RNA…
Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…
A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…
Q: Discuss different systems of biological classification briefly.
A: Introduction In this question we will discuss about the different systems of biological…
Q: -In humans, the ability to roll the tongue is a dominant trait. If a man is homozygous dominant for…
A: 1. In humans, the ability to roll the tongue is a dominant trait. If a man is homozygous dominant…
Q: What are some of the advantages and disadvantages of utilizing insects as experimental animals in…
A: In various toxicological studies such as in drug toxicity analysis etc. using an insect as an…
Q: a. What role do miscellaneous structures (where applicable) play in the organism's role for…
A: INTRODUCTION External structures are the outer covering all all the livings organisms which provides…
Q: Describe the most significant hormones responsible for sex differentiation. List the most important…
A:
Q: 11. Choose from the following types of inheritance and write in the 1st column which one is…
A: Mendelian inheritance states that the genes assort independently but this doesnot apply to every…
Q: 2. Consider the pre-mRNA molecule shown below. Re-order the events listed, in the sequence they…
A: Introduction : Through transcription process RNA synthesized from DNA. After that RNA processing…
Q: Can the frequencies of all genotypes in a population be determined directly with respect to a locus…
A: The dominant allele causes a dominant phenotype in an individual and is composed of one copy of any…
Q: What is the relationship of osmosis to enzymatic browning?
A: Enzymatic browning is a process of food turning brown in color.
Q: Please make a conclusion for this, thank you so much! :) An ear of corn has a total of 381 grains,…
A: "Genetics" is the study of the functioning and main codes of variation and heredity. Inheritance is…
Q: Gene and regulation of gene activity.
A: Gene regulation means how a cell regulate which genes are expressed among many other genes and…
Q: The first 15 bases of the original coding informational strand of DNA (which continues after what is…
A: Mutation can be divided into several categories. The types of mutation include missense mutation,…
Q: phrases are used.) CODIS The most useful DNA markers for forensics are in the population and do not…
A: The most useful DNA markers for forensics are SSR in the population and do not contribute to…
Q: What important biological characteristics of life depend on mitotic cell division?
A: Cell division is a process that results in the development of two daughter cells is named Mitosis.…
Q: what are the advantage and disadvantages of planting native trees in an urban area
A:
Q: Consider a person without any functioning plasma cells. What effects would this condition have on…
A: Plasma cells are round or ovoid cells that contain colored cytoplasm with a pale perinuclear area of…
Q: What is the other pathway of antigen processing? What is the advantage of having two distinct…
A: Antigen processing, also known as the cytosolic pathway, is an immune mechanism which prepares…
Q: Which of the following muscles did he use?
A: Muscles are soft tissues. Many stretchy fibers make up muscles. Different types of muscles have…
Q: Let's Apply In each of the following DNA sequences, write on your answer sheet the corresponding…
A: DNA ( Deoxyribonucleic acid ) is two stranded helical structure which act as genetic material in…
Q: Why is mutation important to evolution if it is the microevolutionary force t
A: Mutation is the process in which the DNA sequences are changed due to misplaced entries, deletion or…
Q: what is the current prevalence of diabetes and how has it changed over time (10-20) years. Provide…
A: currently About 422 million people worldwide have diabetes, the majority living in low-and…
Q: For some traits, one allele is not completely dominant to another. Incomplete dominance occurs when…
A: Incomplete dominant traits are those traits in which one allele is not completely dominant to…
Q: mechanisms of locomotion that this organism can have?
A: 1.They move by using their muscles to push their scales against the ground
Q: 6. Assume height in a particular plant to be determined by 2 pairs of unlinked polygenes, each…
A: Since you've asked multiple questions, we're answering only the first three for you. If you want any…
Q: rationale for synthesizing and rapidly degrading p53 protein
A: p53 protein synthesised byTP53 (tumour protein 53) is a 393 amino acids long protein and is known…
Q: Explain comprehensively how the ganglia originated embryologically? How do these affect the role…
A: The "nervous system", also known as the neural system, is a complicated network of neurons that are…
Q: Which of the following outcomes is most likely to occur if pure phospholipids are added to water?…
A: A phospholipid molecule has two hydrophobic fatty acid tails and one hydrophilic phosphate moiety,…
Q: Are double-knockout animals (DKOs) and even triple-knockoutanimals (TKOs) also possible ?
A: Knockout is the term which is used for the genes. knocking out the gene means that inhibiting its…
Q: How do studies of brain development in knockout mice support the statement that apoptosis is a…
A: Apotopsis is a process of programmed cell death. It is a process in which the cell division is…
Jim’s jaundice is caused by the accumulation of bilirubin in his blood and tissues. What is the normal fate of bilirubin, and what role does the liver play? Explain how cirrhosis is related to Jim’s jaundice.
Step by step
Solved in 3 steps
- Name examples of each of these functions of the liver: 1) endocrine 2) hematologic 3) deactivation of a medicationWhat is jaundice? What function of liver involves the conjugation of bilirubin? List at least 5 disorders causing: Pre-hepatic jaundice Hepatic jaundice Post-hepatic jaundiceMorgan has been overweight for years. Recently, he developed abdominal pain that occurs every few days. The pain usually starts within 30 minutes after a fatty or greasy meal and can last for one to five hours. Preliminary diagnosis indicates stones formation at location X as shown in Figure 1. Liver- X Figure 1 (i) Identify the organ labelled “X". (ii) Analyse why Morgan usually experienced pain within 30 minutes after a fatty or greasy meal. (iii) Suggest two possible treatments for Morgan.
- The diagram shows a liver lobule. Long-term destruction of the hepatocytes, collapse of the histologic architecture, and production of fibrous material in the areas indicated by the arrow is most likely to result in which of the following? 1. A) Decreased intestinal motility 2. B) Gallstones 3. C) Increased central venous pressure 4. D) Increased hepatic venous pressure 5. E) Increased portal pressureJim showed a prolonged clotting times and excessive bruising that are related. Again, referring to normal physiological functioning of the liver, why do these two things happen when alcohol damages hepatocytes?What is cirrhosis of the liver, and what can trigger it?
- Inflammation of the digestive tract is common to most irritable bowel diseases including Crohn’s Disease, IBD Syndrome, and Celiac’s Disease. While each of these diseases causes inflammation by a different mechanism, they all result in decreased capacity to absorb nutrients and minerals. In extreme cases, this can lead to severe diarrhea, malnutrition, osteoporosis (weakening of the bones), and iron deficiency, to name a few. Based on the information above, which region(s) and structure(s) of the alimentary canal is (are) most likely targets of inflammation? Explain your answer based on the roles of each segment of the alimentary canal.How could surgical resection of the ileum impact liver function? Consider the intricate interplay between the small intestine and liver in nutrient absorption, bile acid metabolism, and liver function. What are two potential interventions to alleviate the impacts listed above?Foods high in purines can trigger a gout attack. Provide several examples of these foods and explain how they contribute to this malady. (Read the online essay on gout.)
- During liver failure, what specific amino acids should be used in order to ameliorate the existing diseases condition? Why have you selected these amino acids?List 2 substances that are produced in the liver:identify and describe the following digestive system disorders and their causes. A. Acid reflux B. Heartburn C. Gastric ulcers