Is there a set memory reserve for every declaration statement?
Q: a CD ROM is a small disk that can be read
A: Ans: True that a CD ROM is a small disk that can be read as the CD ROM (Compact disc read-only memor...
Q: In the computer world, who is known as the "father" of the Intel Pentium chip?
A: The answer is given below.
Q: 3. Prove that (P =Q) = R has the same truth with (P = R) ^ (Q=R). We write (P=Q)=R= (P=R) ^ (Q=R).
A: Given: Prove that (P⇒Q) ⇒ R has the same truth with (P⇒ R) ^ (Q⇒R).
Q: The NOS-Network Operating System is provided by a number of different firms.
A: NOS ( Network Operating System ) : It is a type of Operating system. NOS manages network resources ...
Q: What do assembly language instructions like MIV signify, and what are they called?
A: Introduction: Assembly language instructions. The designer can program in assembly language in terms...
Q: explain the process of identifying the various types of instructions. Give an example of each type o...
A: An instruction is a rule that is created to perform some operation and generate an outcome from it...
Q: When compared to a stack, what is the benefit of using a heap?
A: Data is organized in a heap in a much more efficient and predictable way than it is in a stack. This...
Q: BEFORE Apple Grape Peach Banana Plum Orange AFTER Apple Grape Banana Plum Orange Pear a. Give the po...
A: Explanation: Create a list containing fruits and print the original list. Now change the element of...
Q: Instructions: Below is the procedure in saving the file. Fill in the missing commands in each number...
A: A file is a storage system or structure wherein data can be stored and retrieved. It is the most use...
Q: What is discipline-specific database?
A: A Discipline-specific database is a collection of specialized information with a narrow focus. The b...
Q: Let L1, L2, and L3 be languages over some alphabet. In each case below, two languages are given. Say...
A: 1. Both are not always equal.
Q: Subject - Data Communication Networks. Explain how CSMA/CD work Discuss the benefits and drawbacks ...
A: The above question that is work of csma/cd and drawback and benifits of TDM is answered below step ...
Q: create a new python file name "mycode1.py"
A: Python is an interpreted excessive-level fashionable-reason programming language. Its layout philoso...
Q: Construct a PDA that accepts the language generated by the grammar: S → aSb | AB | ε A → Ba | ccc ...
A: Here is the detailed explanation of the solution
Q: Signed vs unsigned numbers: what are the effects on memory?
A: Dear learner , hope you are doing well , I will try my best to answer this question. Thank You!!
Q: ite a program InOrder that reads in three different integers and prints the three integers in ascend...
A: In Python we use input function to get input from the user. We can use it like this a = input (" En...
Q: Write, compile, and test the Comments class that uses the command window to display the following st...
A: Here is the detailed explanation of the code.
Q: Discuss the benefits and drawbacks of multifunctional pins on a microcontroller.
A: the answer is given below:-
Q: What is the purpose of the new risk management framework? What makes it better than the prior method...
A: Risk management framework: The Risk Management Framework is a format and rule utilized by organizati...
Q: a. Write a program that will display the 2 times table on the form as 2X1=2, 2X2=4, 2X3=6 and so on....
A: Note: As per our guidelines we are supposed to answer only one question. Kindly repost the other que...
Q: Explain the different tools and techniques for charter development.
A: What is Charter development? Develop Project Charter is the process of developing a document that fo...
Q: dered linear or non-linear data structu
A: Are linked lists considered linear or non-linear data structures, depending on their structure
Q: A multicore computer is a computer that
A: A multicore computer is a computer that has a lot of different parts.
Q: What do the Sherman Act and the Clayton Act address? Describe each of the acts and how they are used...
A: Answer : Sherman Act 1890 The Sherman Anti-Trust Act was the first Federal act that outlawed monopol...
Q: Who was the first person to develop a computer processor
A: Introduction; The First Mainframe Computer has Invented: Mainframe computers are typically utilized ...
Q: 7. If the formula in CELL A4 is copied to cell B5, what value will appear in that cell? A C 1 1 2 3 ...
A: =A1+B1 will return the sum of A1 and B1 it is A1 is 1 B1 is 2 So the result is 3.
Q: Nowadays, thanks to technological advancements, the majority of appliances are wireless-capable. Is ...
A: I attached your answer below.
Q: Part B. Arrange the following growth functions from the smallest running time to the biggest. 6. 4n ...
A: Arranged the given growth functions from the smallest to biggest running time
Q: Q)write and apply porngineinctt) to convert Srom centigrate to fahrenleite where F =c x2 %3D
A: PROGRAM EXPLANATION: Include the header file. Define the main function. Take input temperature and ...
Q: How do you find out what kind of motherboard you have in order to fix it?
A: Introduction: How do you find out what kind of motherboard you have in order to fix it?
Q: Based on Figure 1, use forward chaining approach to derive conclusion, if the working memory consist...
A: As you mentioned Based on Figure 1 - But the figure was missing in the question. Please provide the ...
Q: Write a Java Program to count the total number of characters in a string
A: import java.util.Scanner; public class Count_WordOfString{ public static void main(String args[]){ S...
Q: How do you find out what kind of motherboard you have in order to fix it?
A: Answer: In rare circumstances, the System Information option in Windows might reveal the motherboard...
Q: Translate the following C statement to an equivalent MIPS assembly program. Assume that the variable...
A:
Q: What is /0 (Zero) character
A: The zero character /0 is nothing but the ASCII starting character.
Q: Which of the following propositions represents the logic circuit below.
A:
Q: Identify three of the factors that EIGRP hub-and-spoke scalability relies on. (Choose three.) a. You...
A: EIGRP hub and spoke:- EIGRP hub and spoke network, in this, we have one or more stub networks are co...
Q: Question 2: A student will not be allowed to sit in exam if his/her attendance is less than 75%. Tak...
A: According to the information given:- We have to follow the instruction and code to get desired outpu...
Q: How do you find out what kind of motherboard you have in order to fix it?
A: Introduction : Motherboards: The primary circuit board inside a computer is a motherboard in compute...
Q: 1. Controlled Path travels from one position to another without maintaining a known path. Select one...
A: Answer for both mcq with explanation given below
Q: The non-preemption of fair queues leads to a different transmission order than with bit round-robin ...
A: The non-preemption of fair queues leads to a different transmission order than with bit-by-bit round...
Q: In the computer world, who is known as the "father" of the Intel Pentium chip?
A: In the computer world, Vinod Dham is known as the "father" of the Intel Pentium chip.
Q: Associations between variables: (Python + Report) Compute the sample correlation coefficient between...
A: Average time spent per page: (Python + Report) We would like to estimate the average time spent on a...
Q: will apps eventually make the web irrelevant? why or why not?
A: Introduction : Irrelevant : When you say something is irrelevant, you're implying that it has nothin...
Q: In what year did the 8-track come out?
A: Managing and Archiving Audio Files: Over the previous two centuries, the size, capacity, and medium ...
Q: What is your opinion between fake and factual information in the internet?
A: The internet is a fantastic tool. It enables us to communicate with individuals from all over the wo...
Q: What are the most pressing email security issues?
A: Introduction: The most serious security problems concerning email communications security,
Q: What are some of the societal ramifications of a growing proportion of the global population using s...
A: In 2017, more than one billion people throughout the world used cellphones. This accounts for over h...
Q: Define the characteristics that are required for test-driven development. In the event that you wish...
A: Test-driven development refers to a style of programming in which three activities that are: coding,...
Q: SELECT ALL of the class fields/variables from the class declaration below.
A: Here, I have to choose an option for the above question.
Is there a set memory reserve for every declaration statement?
Step by step
Solved in 2 steps
- Do all of the declaration statements cause a certain amount of memory to be reserved, or just part of them?The C++ ___ operator returns dynamically allocated memory to the system for reuse. return remove detach deleteCode in Java using Break Statement This code should use break statement (see more details in the photo below)
- Q2: (Debugging Code) : As you are learning to program in C, you will often spend a lot of time debugging code and finding errors. It takes a lot of practice to develop this skill. There are many errors in the following program. Find and correct all the errors so that the program compiles and produces the correct output. (Add a new comment on line 1 of the code and list the errors.) Find all the errors challenge * includeWrite code:Describe Operations on Pointer Variables.C++ please: Passwords are frequently used as a common means of authentication. It is also known that weak passwords are prone to brute force and dictionary attacks and can fail, leading to unauthorized access into user accounts, compromising security. To improve upon the robustness of the password chosen by a user, certain guidelines or requirements can be framed. Write a C++ program that accepts a user suggestion/choice of a password and checks if the chosen password satisfies the following requirements. The password contains: . at least 8 characters . at least one letter from the alphabet . • at least one decimal digit . at least one of the special characters: !, #, &, -, %, or @ The program displays an error message if all the conditions are not met. The error message should point out which requirement was not met so that the user can try setting up a different password. The program should keep checking the passwords, approve the password only if all# Python 3 def printFunction(num1, num2): num3 = num1 + num2 return num3print(num3) Explanation: Here, num3 is the local variable that is defined in the scope of the function and when it is used outside the function, an error occurs. Print(num3) is the statement which is outside the scope of the function. So, when this statement is executed, there is no variable named num3 to be printed, so it gives an error. The error that occurs is : NameError: name 'num3' is not defined Construct a function that takes an argument. Give the function parameter a unique name. Show what happens when you try to use that parameter name outside the function. Explain the results. Show what happens when a variable defined outside a function has the same name as a local variable inside a function. Explain what happens to the value of each variable as the program runs.Consider the following pseudo code, Method func() { PRINT “This is recursive function" func() } Method main( { func() } What will happen when the above snippet is executed?True/False 7. Python functions can never modify a parameterIf an argument is given into a reference parameter, it will be treated as if it were a reference parameter.C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…SEE MORE QUESTIONS