int x; int* intPtr; Write a C++ program that contains five more statements. The first statement makes intPtr point to x by using the address-of operator. The second statement dereferences intPtr and stores the value 5 into x via indirect addressing. The third statement prints the actual memory address of where the variable x is stored. The fourth prints the contents of intPtr. The fifth prints the contents of x. Show your source code and program output.

int x; int* intPtr; Write a C++ program that contains five more statements. The first statement makes intPtr point to x by using the address-of operator. The second statement dereferences intPtr and stores the value 5 into x via indirect addressing. The third statement prints the actual memory address of where the variable x is stored. The fourth prints the contents of intPtr. The fifth prints the contents of x. Show your source code and program output.

C++ Programming: From Problem Analysis to Program Design

8th Edition

ISBN:9781337102087

Author:D. S. Malik

Publisher:D. S. Malik

Chapter12: Points, Classes, Virtual Functions And Abstract Classes

Section: Chapter Questions

Problem 1TF

See similar textbooks

Similar questions

Task related to pointers : Write a c++ program that asks the user to enter integers as inputs to be stored in the variables 'a' and 'b' respectively. There are also two integer pointers named ptrA and ptrB. Assign the values of 'a' and 'b' to ptrA and ptrB respectively, and display them. ( Drop code in words , explain the code and drop the screenshot of output as well )
Instructions: You are strictly not allowed to use anything other than pointers and dynamic memory. One function should perform one functionality only. Task 1 Write a program in C++ that reads data from a file. Create dynamic memory according to the data. Now your task is to perform the following task. Row wise Sum Column wise Sum Diagonal wise Sum Example data.txt 4 5 1.6 10.2 33.7 99 20.5 3 44 50 96.1 2 8 9 4 74 50 99 19.1 Output: Sum row wise: 165, 191, 17, 242.1 Sum col wise: 127.6, 120.1, 228.8, 118.1, 20.5 Sum diagonal wise: Not Possible Note: You are restricted to use pointers and your function should be generic. Avoid memory wastage, memory leakage, dangling pointer. Use regrow or shrink concepts if required.
select the correct answer that describes the C++ statement Q/ int *ptr = &x; cout << * ptr; Ans/ 1/ print the address of the pointer variable ptr on the screen 2/ print the address stored in ptr on the screen 3/ print the address of x on the screen 4/ print the value pointed by ptr on the screen
TRUE or FALSE - In C++, a function can't return a pointer. Select one: a.FALSE b.TRUE
int x; int* intPtr; Using the above C++ statements I am trying to create a C++ program that contains five more statements. The first statement makes intPtr point to x by using the address-of operator. The second statement dereferences intPtr and stores the value 5 into x via indirect addressing. The third statement prints the actual memory address of where the variable x is stored. The fourth prints the contents of intPtr. The fifth prints the contents of x. Show your source code and program output.
2- In C++ language, every line of code must end with a semicolon. (True or False). 3- It is not possible to change the value of the pointer. (True or False). 4- If the following lines of code have errors, correct them; otherwise, write "no errors." for (int i=2; i<5; i++) { int s=i*2; } cout << S; 5- A function cannot be called from inside another function. (True or False). 6- How to make a function return multiple values? 7- Every class member is by default. (public, private, not public nor private) 8- Create an instance of the following class and call its methods. class Exam{ int grade; public: void seta (int b) (grade=b; } int geta () {return grade; } 9- When the word const is put before the variable definition, what does that mean? 10- How to concatenate two strings in C++ language? C++
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
How do you build a C++ program that asks the user to enter three integer values as input and stores the values into three different variables? Additionally, for each variable, create an integer pointer to dynamic memory and display the contents of the variables and pointers. Furthermore, be sure to use the new operator and delete operators to manage memory. Please and thank you
You need to write a program in C that will allow a teacher to store, update and view the grades of multiple students. The program should perform the following operations: Add a new student and their grades for different subjects. View the grades of a particular student. Update the grades of a particular student. View the average grades of all students.The program should store the following information for each student: Student name (string) Roll number (integer) Grades for 5 subjects (integers)The program should implement a menu-driven interface for the user to perform the above operations. The program should continue to run until the user selects to exit.Constraints: The student name should not exceed 50 characters. The roll number should be a positive integer and should be unique for each student. The grades should be integers in the range [0, 100].
In C language, write a program to input two integers x,y and add both the integers using pointers and display the result in the output. The assignment will be rejected if the numbers are added without the use of pointers.
Month Day Calculator in C Using basic concepts of Pointers and Structures (Pointers and Multi-dimensional arrays), create a C program that calculates the month's day from a given year and year's day. Use pointers for the month and month's day variables. Don't forget to add proper errors handling in your program. - Follow the instructions below for handling error. - Invalid Input- Invalid year- Invalid year day Modify the provided monthAndDay.c class file to receive the parameters in the way and also print the proper formatted output. Example: # ./month_day <year> <yearday> # Example for Feb 2nd, 2019:\$ ./month-day 2019 33Feb 02, 2019 class- monthAndDay.c - #include <stdio.h> /* monthAndDay function's prototype*/void monthAndDay(int year, int yearday, int *pmonth, int *pday); int main() {return 0;}
Assembly language Part 1: When a variable is stored in memory, it is associated with an address. To obtain the address of a variable, the & operator can be used. Write a C program addressOfScalar.c by inserting the code below in the main function. Questions: 1) Run the C program, attach a screenshot of the output in the answer sheet. 2) Attach the source code in the answer sheet 3) Then explain why the address after intvar is incremented by 4 bytes instead of 1 byte.