Identify what type the volume in the ITEM 8 in the diagram. Choose the letter of the correct answer from the choices below. M 1600 pm CA Created in Bender.com ble A Total Genomic DNA Isolation 16000 A Total Genomic DNA Isolation O A. P-2 B. P-10 OC. P-20 MI 201 12,000 Created in Binder.com blo

Identify what type the volume in the ITEM 8 in the diagram. Choose the letter of the correct answer from the choices below. M 1600 pm CA Created in Bender.com ble A Total Genomic DNA Isolation 16000 A Total Genomic DNA Isolation O A. P-2 B. P-10 OC. P-20 MI 201 12,000 Created in Binder.com blo

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: 1. Which of the pairs of amino acids gives a positive result to Xanthoproteic test?* Tyrosine and…

A: Biological Macromolecules are constituted of nucleic acids, proteins, lipids and carbohydrates.

Q: Which of the following best characterizes ANABOLISM? 1.It is largely exergonic reaction because it…

A: The process of metabolism encompasses both anabolism and catabolism.

Q: There is a medical condition called Syndrome of Inappropriate Anti-Diuretic Hormone (SIADH)…

A: 1. There is a medical condition called Syndrome of Inappropriate Anti-DiureticHormone (SIADH)…

Q: Which of the following processes take place in the cytoplasm? (Select all that applies) Krebs…

A: The eukaryotic cell of animal composed of various macro and micro cell organelles like mitochondria,…

Q: Refer to the statements below: 1. An amino acid is considered glucogenic if it has a…

A: There are twenty standard amino acids that make up all the proteins present inside the cell. Amino…

Q: a) The genetic code in unambigous that means many codons can code for the same amino acids. b)…

A: 1. The genetic code is UNAMBIGUOUS:- Means that each triplet specifies only a single amino acid.…

Q: Please follow the discussion in the photo upon answering the problem below. Please provide an…

A: Field efficiency is described as the ratio of effective field capacity to theoretical field capacity…

Q: 1. Which of the following is the coenzyme of riboflavin (B2)? A. FAD and FMN B. NAD or NADP C.…

Q: What is the importance of redox couple in metalloproteins, explain using. an example

A: Introduction: A redox couple contains both the oxidized and reduced form of a compound that is…

Q: Which of the following enzymes are activated after insulin binds to its receptor? (select all that…

A: Insulin is classied as one of the major hormone that plays a major role in controlling…

Q: Eukaryotes modify mRNA with an m7G cap: an N7-methylated guanosine linked via a 5′ to 5′…

A: The capping of the mRNA is a mechanism to prevent the degradation of the mRNA strand by the…

Q: TRUE OR FALSE: a) Each tRNA has unique identity elements recognized by its specific enzyme involved…

A: Translation is the process where individual aminoacids are joined by forming peptide bond . It…

Q: A partial amino acid sequence from the tick anti-coagulant protein is:…

A: The genetic code is a set of three-letter combinations of nucleotides called codons that corresponds…

Q: "a messenger rna is 423 long how many amino acids it can code"

A: Introduction: Genetic code is the nucleotide base sequence on DNA ( and subsequently on mRNA by…

Q: Which of the following types of bonds are present in the primary structures of proteins?…

A: The development of the three dimensional structure of a protein involves four levels of organization…

Q: What is the common purpose of the amaerobic breakdown of pyravate in both yeast and muscle cell ? Be…

A: Introduction: Fermentation involves the conversion of sugar to alcohol in the presence of yeast. It…

Q: Describe briefly the hydrolysis reaction for carbohydrates as indicated to the picture A. What organ…

A: Insulin and glucagon are the hormones that control blood sugar levels. These hormones are of…

Q: How to use CRISPR cas 9 system to solve a problem or disease in molecular biology

A: CRISPER cas9 is the gene-editing tool that edits the parts of the genome by removing, adding, or…

Q: Define the pedigree symbol(s) associated with each of the following individuals. Please be as…

A: Pedigree: Pedigree is a family tree that is used to show the mode of inheritance of genetic traits/…

Q: xplain briefly but concisely 3. Mammalian liver can carry out gluconeogenesis using oxaloacetate as…

A: Gluconeogenesisis the process that requires energy. It is not a simply the reversal of process of…

Q: If we attached an amine group (NH₂) to Carbon 4, what type of amine will be the result? A. Primary…

A: Amines are organic compounds that contain nitrogen atoms with a lone pair.

Q: electron transport chain,

A: The ETC stand for electron transport chain system. It helps to transfer the electron from various…

Q: plant foods often contain oxalates and phytates. what effects do these have on minerals that are…

A: Phytates and oxalates are present in plant foods. Phytates are other wise called anti nutrients…

Q: For each of the heterocyclic bases, choose a correct characterization from the response list…

A: Nucleic acids are the polymer of nucleotides. Nucleotide is made up of ribose or deoxyribose sugar,…

Q: 1. Which of the following statement/s is/are TRUE for the protein sample?* The sample will give a…

A: Part 1. The Biuret test is used for testing the presence of peptide bonds and can also tell the…

Q: Explain the four stages of external respiration and identify the gradients (driving force) and…

A: The process of breathing is known as respiration. It entails taking in oxygen and exhaling carbon…

Q: 1. make your own version of Lipid Metabolism Cycle with diagram. 2. explain why these cycles are…

A: Glycolysis, TCA cycle, and ETC all are interconnected processes. Metabolism includes biosynthesis/…

Q: pH > 7 in the lungs results in deprotonating of histidine, making it negatively charged.…

A: The pKa of the ionizable side chain of an amino acid determines whether at a particular pH the side…

Q: Consider the peptide EAHIVR. Write out the sequence of the peptide from N to C in three letter code.…

A: The pKa of the ionizable groups of the amino acids constituting a peptide determines the net charge…

Q: Propionic acid is provided (pKa = 2.0) to make a 0.1 M buffer at pH = 2.0. What is the ratio of…

A: Buffer solutions are usually made with an equilibria of acids and their conjugate bases such that…

Q: When making recombinant DNA, why must you use the same restriction enzyme to cut the gene of…

A: The technique of creating multiple, identical copies of a specific portion of DNA is known as DNA…

Q: BIOMOLECULES - MULTIPLE CHOICE - Please answer properly QUESTION : 1. What is the process called…

A: A fatty acid is a carboxylic acid with a long aliphatic chain that can either saturated or…

Q: Polypeptide synthesis (CHOOSE ONE)

A: Proteins are one of the most important macromolecule in living organisms. Proteins are consist of…

Q: A cell sample suspended in a buffer solution was centrifuge at 12,000 rpm. Which of the following…

A: Centrifugation is a frequently used techniques in the cell and molecular biology laboratory. It is a…

Q: Describe three types of the amphipathic lipid aggregates that form in water.

A: The lipids in membranes are either amphipathic or amphiphilic. Amphipathic molecules with a…

Q: How does insulin and glucagon affect the rate of glycogenesis, glycogenolysis, and glycolysis?

A: Introduction: Insulin is a polypeptide hormone produced by beta cells of Langerhans of the pancreas.…

Q: There are no aminoacyl-tRNAs that will go to the A site of the ribosome when UGA is the codon. Is…

A: During termination of protein synthesis, protein synthesis ends when one of the three stop codons:-…

Q: enzyme that converts succinate to fumarate, uses ____ as its coenzyme. FADH2 FAD…

A: Succinate to fumarate reaction- It occurs in the citric acid cycle

Q: 1 4 6 7 8. 9. Transcriptional stop sequence ТАTA box ATG TAA AUG UAA Here is a diagram of a human…

A: The process of transcription catalyzed by RNA Polymerase II in eukaryotes gives rise to the pre-m…

Q: Lipogenolysis is the breakdown of lipids to acetyl CoA true or false

A: Triacylglycerol is an important storage form of energy in the body.

Q: The pentose phosphate pathway: Produces heat through simultaneous activation of both catabolic…

A: Pentose phosphate pathway is a metabolic pathway. It takes place in plastids in plant cell while in…

Q: Most amino acids exist in the L-form because Steric Hindrance is minimum in this form.…

A: D (dextro-rotatory) as well as L (levo-rotatory) stereoisomers are named after the direction…

Q: ) Two ribose subunits are present in the coenzyme flavin adenine dinucleotide. (2) In the common…

A: Flavin adenine dinucleotide is a coenzyme form of the vitamin adenine or B2, with a formula of…

Q: The ultimate acceptor of electrons in the elctron transport chain is ____.

A: At cellular level, the process of aerobic respiration of glucose involves glycolysis,…

Q: BIOMOLECULES - MULTIPLE CHOICE - Please answer properly QUESTION : The coenzyme biocytin is…

A: A coenzyme is a non-protein chemical molecule that forms a bond with an enzyme to catalyse a…

Q: Why is DNA so important

A: DNA is an abbreviation for deoxyribonucleic acid. It includes nucleotides, which are biological…

Q: Answer the following questions briefly and concisely with not more than 5 sentences. QUESTION : What…

A: Most but not all enzymes are proteins. Enzymes are highly specific. Enzymes consist entirely of…

Q: BIOMOLECULES - MULTIPLE CHOICE - Please answer properly QUESTION : From these enumerated functions…

A: The biological macromolecules are constituted of nucleic acids, proteins, lipids and carbohydrates.

Q: biosynthesis. Malate carries acetyl CoA to the cytosol, the site of fatty acid

A: Acetyl-CoA is the primary building block for the synthesis of fatty acids from scratch. However,…

Q: "which of the following can be used to replenish oxaloacetate in the krebs cycle" a. aspartic acid…

A: Replenishment of oxaloacetate in Krebs cycle: The concentrations of the intermediate molecules of…

Question

note: i don't have a clear photo of the diagram, please just analyze it and don't reject the question

Identify what type of micropipette should be used to accurately transfer
the volume in the ITEM 8 in the diagram. Choose the letter of the correct
answer from the choices below.
pika
1000p
14.000
zm
Sof
(Eng)
www.
CTAB N
Created in Blaender.com bio A Total
Total Genomic DNA Isolation
O!
A Total Genomic DNA Isolation
O A.P-2
OB. P-10
OC. P-20
D. P-100
O E. P-200
O F. P-1000
50-100
12:00
Created in Biotender.com bie

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

The following table are the results of spectrophotomety of extracted RNA samples (note: not all OD's reported in this table are relevant for all subsequent questions). Specrophotometry- RNA Extractions Experimental Group Replicate O0260 OD280 OD320 00360 1 0.68 0.38 0.70 0.73 2 1.35 0.75 146 1.38 1.85 1.03 1.93 1.96 1 0.68 0.38 0.80 0.85 2 180 1.00 1.96 1.98 0.96 0.53 1.11 1.18 What is the SSRNA concentration for sample A1? Select one: O a 273 ug/ml O b. 18.9 ug/ml Oc 34.1 ug/ml O d 15.1 ug/ml O e 22.5 ug/ml
Download BLOSUM30 and BLOSUMB0 substitu- tion matrices and place them side by side on your computer screen. What are the differences between the two matrices? Why do you see these differences?
acconline.austincc.edu/ultra/courses/_891351_1/cl/outline O gel electrophoresis O PCR O genomic library DNA microarray A patient is suspected of having a certain type of cancer that involves several genes. Doctors want to determine whether this patient is expressing these cancer genes and to what leve each gene is being expressed. What technique may be used? O molecular cloning O CRISPR gene editing 5 genetic recombination that occurs naturally (think horizontal gene transfer, meioșis, fertilization, or mutations). Ar : Y EV АУ ΩΘΙ 用く X A MacBook Air & 8 88 Q V Ix % 0 8A EXE D B 图 Q 用图 5 d Show All † 19 EHR Immuniza
Cancer develops from the accumulation of multiple mutations within a single cell. Name the 3 sources of these mutations (2017). For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph Arial V 10pt A
Answer each of the following correctly. Designer Genes Work (This is all about Applications of Recombinant DNA) 1. How does DNA Replicate? 2. What is Genetically Modified Organism (GMO)? 3. Illustrate your own Designer genes based on the following: 1. Identify a special trait. 2. Identify a source organism. 3. Identify a target orgsnism 4. Identify the modified/added trait.
. Below is a plasmid map of pBR328, describe its screening procedure. Ncol Mscl EcoRI BspEl Pvull Cm Pvul pBR328 4907 bps Amp Clal Hindill Pstl EcoRV BamHI Tet ColE1 ori Sall
Nikolas is investigating the presence of four different genes (A, B, C and D) in Ladybugs using a PCR technique illustrated below (Figure 2). Deduce FOUR (4) possible reasons why this method is utilized rather than the conventional PCR technique. 422 318 275 232 181 109 Marker 01 PCR with all four primer pairs in a single tube 371 275 202 141 Figure 2
Answer the following questions. 1. Explain the steps associated with DNA profiling and state its advantages and disadvantages, 2. Describe how mutations are linked to DNA polymorphism. GUIDELINES: Each answer should be 250 words in length. Content should not be copied. References and bibliography should be provided for the content and images. please asap
The following chromatogram is obtained from the sequencing reaction. Using the key below, what message did you integrate into the yeast genome? AATATTAAAGTATAGAACGACTGTGAA A B с D E F G H I AAA AAT AAG AAC ATT ATG ATC AGT AGG J K L M N O P Q R Key GGG GGA GGT GGC GAA GAC GAT GTT GTA S T U V W X Y Z (SPACE) TTT TTC TTA TTG TGT TGA TGG TAA TAG
BOTTOM The sequence depicted on the gel is 5'-GTGATGTAG-3' The sequence depicted on the gel is 3'- GTGATGTAG -5' The sequence shown on the gel is the sequence of the template strand of the reaction The sequence shown on the gel is complementary to the template strand of the reaction The template strand of the reaction is antiparallel to the sequence shown on the gel The largest fragment shown on the gel is closest to the top The largest fragment shown on the gel is closest to the bottom Each of the fragments shown on the gel have a primer incorporated at their 5' end Each of the fragments shown on the gel have a primer incorporated at their 3' end The number of nucleotides in the shortest band on the gel is 21 The number of nucleotides in the longest band on the gel is 21 ick Save and Submit to save and submit. Cick Save All Answers to save all answers.
Answer each of the following correctly. Designer Genes Work (This is all about Applications of Recombinant DNA) 1. How does DNA Replicate? 2. What is Genetically Modified Organism (GMO)? 3. Illustrate your own Designer genes based on the following: 1. Identify a special trait. 2. Identify a source organism. 3. Identify a target orgsnism 4. Identify the modified/added trait. Example: Hot Tomato > Chili > Tomato > Spicy Tomato (Look to the picture I provided for this)
Given the electrophoresis profile of a Sanger sequencing result, what was the sequence of the original DNA sample used for sequencing? ddATP ddGTP ddCTP ddTTP - GGTTACC B CCATTGG CCAATGG GGTAACC | | | |