I am reading in two integers from a file. For example my input.txt file has the integers : “4–5” I am able to open the file and store the first value (4) into variable n but I can't store the second integer value (5) into variable m, I think the computer reads the dash as the next integer instead of the actual integer which is 5, how can I create a code that ignores the dash when searching for the integer in the input.txt? Thank you
Q: Python 3.7.4: The file Pioneers.txt contains some computer pioneers and their accomplishments. The…
A: Program:arr = []try: with open('Pioneers.txt','r') as p: for line in p:…
Q: Any help with this question is greatly appreciated!! Thank you!! 1. For this question please…
A: x = 5y = 2r = x % yprint (‘Remainder is:’, r) Explanation: In the above example x = 5 , y =2 so…
Q: Do the following program in Java Eclipse:A veterinarian services many pets and their owners. As new…
A: Program Instructions:Create a java program in eclipse and import all required modules.Now create a…
Q: The cryptography function crypto () takes as input a string(i.e., the name of a file in the current…
A: Code def crypto(file_txt): fin = open(file_txt,'r') for line in fin:…
Q: 6.13: Word Count Write a program that prompts the user to input the name of a text file and then…
A: Actually, program is an executable software that runs on a computer.
Q: Write a simple C program that can determine whether a machine is little- or big-endian.
A: ANSWER: C Program: The C programming language is PC programming language that was made to do…
Q: 1. Write a program that performs arithmetic division. The program will use two integers, a and b…
A: Declare variables a, b and c for division Take inputs from user Print the result
Q: Write a C program which opens file1 which only contains this line: abc and then opens the empty…
A: Step 1 : Start Step 2 : Create a file descriptor (fd1) and open the file named file1 using the open…
Q: (4) Implement the count_non_WS_characters(text_string) function which has a string parameter and…
A: Kindly Note: As per our company guidelines we are supposed to answer only first 3 sub-parts. Kindly…
Q: What is the output of the following code? def test_func (*a) print (a[0]) test_func1,2,3,4) test…
A: Consider the given code:#Function definition test_func()def test_func(*a): #Print the output…
Q: For this question please write a basic python code for each point displaying how the concept is…
A: Note: since question contain multiple sub-parts but we can answer only first 3-sub parts at a time…
Q: A C that adds two very large integers entered by the user on the keyboard write the program. Very…
A: I have provided code in step2.
Q: NEED HELP PLEASE! Write a Java program to read a text file (command line input for file name),…
A: import java.io.*; public class Test{ public static void main(String[] args) throws IOException {…
Q: in c++ When does the following while loop terminate? char ch = 'D'; while ('A' (static_cast (ch) +…
A: given code char ch = 'D';while ('A' <= ch && ch <= 'Z') ch =…
Q: Help me in C# please, this is what I have done so far. I'm stuck at if user input just Enter key, or…
A: Hey there, I am writing the required solution of the above stated question.Please do find the…
Q: For this question please write a python coded program for each concept displaying how each one is…
A: Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: 3. Write a C code that reads name and surname of a person from the keyboard. Then, if the name is…
A: Given that: C program to print name and surname by accepting inputs from the user and printing…
Q: please help me modify the sparse text program below so that instead of the letter 'e' being removed,…
A: We need to update the code to accept the letter after that we need to remove it from the file.
Q: variety of (n is even) numbers a1,a2,… ,an. He considered a positive number k. From that point…
A: Here have to determine about c++ code for procedure on the cluster problem.
Q: 1- The value of s could be calculated from the equation below: Jy? – 4xz if y2 4xz S= inf if y < 4xz…
A: Solution: Given,
Q: Write a simple C++ program that allows the user to create files of random data. They should be…
A: #include <iostream> #include <cstdlib> #include <ctime> #include<algorithm>…
Q: Write a for loop with index i that iterates over all consecutive integers from 4 to 10 and prints…
A: for i in range(4,11): print(i)screenshot of output:
Q: The problem statement is described in the problem_statement.pdf file. Write the solution into the…
A: Below i have answered:
Q: All parts need to be included in the same C file so the new code needs to be added to the existing…
A: C program: #include<stdio.h> void printBin(int value){ int i; // Integer to binary…
Q: he coordinates of two two-dimensional points P(x1,y1) and P 2 (x 2 ,y 2) are inputted through the…
A: Let the given two points be P(x1, y1) and Q(x2, y2). Now, we find the equation of line formed by…
Q: problem statement, One has a variety of (n is even) numbers a1,a2,… ,an. He considered a positive…
A: Here have to determine about c++ code for Polycarp played out problem statement.
Q: In this lab, you open a file and read input from that file in a prewritten C++ program. The program…
A: The given problem is to be solved in C++ programming language where the file is to be read and…
Q: C PROGRAM lets say i have a txt file and in the file there is a text like this : The Catcher in…
A: #include <stdio.h> #include<ctype.h>#define MAX_FILE_NAME 100 int main() {…
Q: Need help with part 2 I was already helped with part one and they told me to repost to get help…
A: Big endian and small endian:- It is two formats for storing multibyte data types in computer memory.…
Q: Write a C program that opens file1 which only contains this line: dcab and then opens the empty…
A: C code:- #include <stdio.h> #include <unistd.h> #include <fcntl.h> int…
Q: A C that adds two very large integers entered by the user on the keyboard write the program. Very…
A: Program Approach: Including the necessary header file. Defining a method "NumDistinctChar" that…
Q: PYTHON without def function iven a file with the name textfile.txt, count and print out 1) the…
A: Kindly indent the code as shown in the screenshot below :
Q: 2. The Fibonacci sequence is defined as numbers in the following integer sequence: 0, 1, 1, 2, 3, 5,…
A: According to the Question below the solution: Output:
Q: Write a program that reads data from a data file, the value of which is provided at the end of the…
A: Follow the below algorithm for creating the program with the given description: Include header…
Q: Hello I need assistance writing code that will print all the numbers between 1 and n (n defined by…
A: ALGORITHM:- 1. Take input for the value of n. 2. Use for loop from 1 to n. 3. Place a condition…
Q: How would I solve this problem in python language Grades a) Write a program that reads in the names…
A: Program Instructions:Use the open() function to read from the file.Save the result o spilt()…
Q: the importent and main Required =: Create a program that processes data with file I/O, nested loops,…
A: Solution:-- 1)As per required in the question is to provide the program in the python language…
Q: Problem description. In C++ In Betjemanian University, everyone has to enter his/her name on a…
A: Please refer below for your reference: Language used is C++: #include <bits/stdc++.h>using…
Q: 2- Write a C+ program that calculates the area of a Rectangleif the user inserts R' or Y, and the…
A: read user choice . if ch==‘R’ || ch==‘r’ then read height and width display height*width if…
Q: In C++ Could someone Write a program that will read a document/txt file thats written in ASCII and…
A: C++ code read ASCII code from text file and convert it into normal text and display
Q: Part 4: Write an average-of-three-numbers program This program will get three integers from the user…
A: GIVEN:
Q: write a program in C to create and store information in a text file.
A: #include <stdio.h>#include <stdlib.h> int main(){ char str[1000]; FILE *fptr;…
Q: Do not add statements that call print , input , or open , or add an tmport statement. • Do not use…
A: def get_lat_lon_distance(lat1: float, lon1: float,lat2: float, lon2: float) -> float:…
Q: [35%] Jojo got some difficulties in searching a name. Help him to make a program to find a specific…
A: #python program #opening file for reading input f=open("a.txt","r") for i in…
Q: C++ program
A: Given :- In the above question, the statement is mention in the above given question Need to write…
Q: C statements which tests to see if file has opened the data file successfully. If not, print an…
A: C code: #include <stdio.h>#include <string.h>#include <stdlib.h> void main() {…
Q: Please code in python Kiki is making “Happy National Pizza Day” (February 9th) cards for all of her…
A:
Q: Need help with part 2 I was already helped with part one and they told me to repost to get help…
A: Here we write simple to print number in binary :…
Q: I need help with this homework question. Someone answered before but the output was incorrect.…
A: Given: To write a C++ program that prompts the user to input the name of a text file and then…
Good day/evening , C++ help needed.
I am reading in two integers from a file.
For example my input.txt file has the integers : “4–5”
I am able to open the file and store the first value (4) into variable n but I can't store the second integer value (5) into variable m, I think the computer reads the dash as the next integer instead of the actual integer which is 5, how can I create a code that ignores the dash when searching for the integer in the input.txt? Thank you
Step by step
Solved in 2 steps
- In C++ (don't copy paste the same answer that is already on this site, post unique code) Structures A menu-driven program gives the user the option to find statistics about different baseball players. The program reads from a file and stores the data for ten baseball players, including player’s team, name of player, number of homeruns, batting average, and runs batted in. (You can make up your data, or get it online ) Write a program that declares a struct to store the data for a player. Declare an array of 10 components to store the data for 10 baseball players. The program prints out a menu (in a loop, so this can be done again and again) giving the user a choice to: print out all users and statistics print out the statistics for a specific player print out all data for a specific team update the data for a particular player (change one of the statistics) DO ALL WORK IN FUNCTIONS. USE A FUNCTION TO READ THE DATA, A FUNCTION TO PRINT THE MENU, and FUNCTIONS FOR EACH OF THE MENU…Use C++ In a student file, there are names and scores. Find the max score and print out the names of the students with the max score. • You must get a filename as standard input. See two sample outputs on the next page. • The number of students in the file is at most 50. • You need to make two arrays (see the next page). 1. Create a string array with size 50. The array will store the names of the students. 2. Create an integer array with a size of 50. The array will store the scores of the students.python:def ohno_twozero(placeholder, statement): """ Question 1 - Regex You are typing a personal statement but accidentally used the number 0 instead of the letter o (the two are very close on the keyboard). After realizing this, seeing the mistake once does not bother you, but you absolutely cannot tolerate seeing it twice in a row. Therefore, you will need to replace any WORD where '00' shows up at any point with the given placeholder. Do not replace any NUMBER where 00 shows up. (e.g. '100' should stay as '100' and not be replaced with the placeholder). You may assume that when '00' shows up in a word, there will be at least one letter preceding it. Return the output string after making these changes. THIS MUST BE DONE IN ONE LINE. Args: placeholder (str) statement (str) Returns: str >>> ohno_twozero('epic', "I am n0w l00king at 500 t0tal h0urs 0n Super Smash Br0s.") "I am n0w epic at 500 t0tal h0urs 0n Super Smash…
- Python programming-basics homework assignment: Write a program that inputs a text file, should print unique words in file in abc order, uppercase words should take precedence over lower. this is example of output: example text file: brown dog fox jumps lazy over quick the example output: brown dog fox jumps lazy over quick the THis is MY output: thequickbrownfoxjumpsoverthelazydog This is my code: QUESTION: why it won't SORT or removing unique text like example output: # Put your code herefileName = input("Enter the input file name:")word_list = []with open(fileName) as words: for line in words: line.rstrip() for list_of_words in line.split(): print(list_of_words) word_list.sort() for list2_words in word_list: if list2_words not in word_list: word_list.sort() word_list.append(list_of_words) for new_words in line.split(): print(new_words)You will have an orthogonal triangle input from a file and you need to find the maximum sum of the numbers according to given rules below; 1. You will start from the top and move downwards to an adjacent number as in below. 2. You are only allowed to walk downwards and diagonally. 3. You can only walk over NON PRIME NUMBERS. 4. You have to reach at the end of the pyramid as much as possible. 5. You have to treat the input as pyramid. 215 193 124 117 237 442 218 935 347 235 320 804 522 417 345 229 601 723 835 133 124 248 202 277 433 207 263 257 359 464 504 528 516 716 871 182 461 441 426 656 863 560 380 171 923 381 348 573 533 447 632 387 176 975 449 223 711 445 645 245 543 931 532 937 541 444 330 131 333 928 377 733 017 778 839 168 197 197 131 171 522 137 217 224 291 413 528 520 227 229 928 223 626 034 683 839 053 627 310 713 999 629 817 410 121 924 622 911 233 325 139 721 218 253 223 107 233 230 124 233 Need the answer in pythonYou will have an orthogonal triangle input from a file and you need to find the maximum sum of the numbers according to given rules below; 1. You will start from the top and move downwards to an adjacent number as in below. 2. You are only allowed to walk downwards and diagonally. 3. You can only walk over NON PRIME NUMBERS. 4. You have to reach at the end of the pyramid as much as possible. 5. You have to treat your input as pyramid. According to above rules the maximum sum of the numbers from top to bottom in below example is 24. *1 *8 4 2 *6 9 8 5 *9 3 As you can see this has several paths that fits the rule of NOT PRIME NUMBERS; 1>8>6>9, 1>4>6>9, 1>4>9>9 1 + 8 + 6 + 9 = 24. As you see 1, 8, 6, 9 are all NOT PRIME NUMBERS and walking over these yields the maximum sum. According to rules what is the maximum sum of below input? It means please take this input (as file or constants directly inside the code) for your implementation and solve by using it.…
- You will have an orthogonal triangle input from a file and you need to find the maximum sum of the numbers according to given rules below; 1. You will start from the top and move downwards to an adjacent number as in below. 2. You are only allowed to walk downwards and diagonally. 3. You can only walk over NON PRIME NUMBERS. 4. You have to reach at the end of the pyramid as much as possible. 5. You have to treat the input as pyramid. 215 193 124 117 237 442 218 935 347 235 320 804 522 417 345 229 601 723 835 133 124 248 202 277 433 207 263 257 359 464 504 528 516 716 871 182 461 441 426 656 863 560 380 171 923 381 348 573 533 447 632 387 176 975 449 223 711 445 645 245 543 931 532 937 541 444 330 131 333 928 377 733 017 778 839 168 197 197 131 171 522 137 217 224 291 413 528 520 227 229 928 223 626 034 683 839 053 627 310 713 999 629 817 410 121 924 622 911 233 325 139 721 218 253 223 107 233 230 124 233You will have an orthogonal triangle input from a file and you need to find the maximum sum of the numbers according to given rules below; 1. You will start from the top and move downwards to an adjacent number as in below. 2. You are only allowed to walk downwards and diagonally. 3. You can only walk over NON PRIME NUMBERS. 4. You have to reach at the end of the pyramid as much as possible. 5. You have to treat your input as pyramid. According to above rules the maximum sum of the numbers from top to bottom in below example is 24. *1 *8 4 2 *6 9 8 5 *9 3 As you can see this has several paths that fits the rule of NOT PRIME NUMBERS; 1>8>6>9, 1>4>6>9, 1>4>9>9 1 + 8 + 6 + 9 = 24. As you see 1, 8, 6, 9 are all NOT PRIME NUMBERS and walking over these yields the maximum sum. Write code for below problem in C languageYou will have an orthogonal triangle input from a file and you need to find the maximum sum of the numbers according to given rules below; 1. You will start from the top and move downwards to an adjacent number as in below. 2. You are only allowed to walk downwards and diagonally. 3. You can only walk over NON PRIME NUMBERS. 4. You have to reach at the end of the pyramid as much as possible. 5. You have to treat your input as pyramid. According to above rules the maximum sum of the numbers from top to bottom in below example is 24. *1 *8 4 2 *6 9 8 5 *9 3 As you can see this has several paths that fits the rule of NOT PRIME NUMBERS; 1>8>6>9, 1>4>6>9, 1>4>9>9 1 + 8 + 6 + 9 = 24. As you see 1, 8, 6, 9 are all NOT PRIME NUMBERS and walking over these yields the maximum sum. According to RULES that you implemented what is the maximum sum of below input? It means please take this input (as file or constants directly inside the code) for your implementation and…
- You will have an orthogonal triangle input from a file and you need to find the maximum sum of the numbers according to given rules below; 1. You will start from the top and move downwards to an adjacent number as in below. 2. You are only allowed to walk downwards and diagonally. 3. You can only walk over NON PRIME NUMBERS. 4. You have to reach at the end of the pyramid as much as possible. 5. You have to treat your input as pyramid. According to above rules the maximum sum of the numbers from top to bottom in below example is 24. *1 *8 4 2 *6 9 8 5 *9 3 As you can see this has several paths that fits the rule of NOT PRIME NUMBERS; 1>8>6>9, 1>4>6>9, 1>4>9>9 1 + 8 + 6 + 9 = 24. As you see 1, 8, 6, 9 are all NOT PRIME NUMBERS and walking over these yields the maximum sum. According to rules that you implemented what is the maximum sum of below input? It means please take this input (as file or constants directly inside the code) for your implementation and…The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcompositionUse pythonThe file "dna.seq" (on Blackboard) consists of several DNA sequences. Write a program that reads in the file "dna.seq” and counts the number of sequences with the following properties: • The total number of sequences in the file • The number of sequences that have the pattern CTATA • The number of sequences that have more than 1000 bases • The number of sequences that have over 50% GC composition • The number of sequences that have more than 2000 bases and more than 50% GC composition Some program requirements: (1) the program should prompt the user for the filename. (2) each of the above tasks should be its own function. dna seg file = CAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTATACCGCGAAACTGCGAATGGOTCATTAAATCACT TATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGOTAATACATGOTAAAAAGO CCGACTCACGGAGGGTTGTATTTATTAGATTAAAAA