Q: F₁ generation 1. Parents with the following genotypes were crossed: RR x rr 2. Make a Punnett Square…
A: One of Gregor Mendel's great discoveries was the Principle Of Dominance. He noted that when he…
Q: Please answer fast What is "variable penetrance"? Explain why autosomal dominant disease penetrance…
A: Autosomal disease The disease which is caused by the autosomal set of chromosome except the X and Y…
Q: Q1: What is natural selection selecting for here? Q2: Why do bacteria that are not genetically…
A: Natural selection is the process in which the environment selects its organism naturally depending…
Q: Assume that short ear lobes in humans are an autosomal dominant trait that exhibits 60% penetrance.…
A: The unit of heritance which carries information from one generation to the next is called genes.…
Q: Why is it important to know if the bacteria is encapsulated or not?
A: Some bacterial cells are surrounded by a viscous substance called a capsule, which forms a covering…
Q: Which of the following statements is TRUE about phospholipids?
A: Phospholipids are mainly found in cell membranes. They are a combination of a lipid molecule and a…
Q: 1. Phenylethyl alcohol (PEA) agar is a selective media. Which of the following organisms should NOT…
A: The comprehensive research of microorganisms, whether they have one cell, many cells, or are…
Q: Explain the processes of aerobic respiration in mitochondria of a cell and anaerobic respiration in…
A: Respiration is a process by which food is used by living organisms to get energy. During this…
Q: Remove codons 24 to 66, inclusive AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGU
A: GENETIC CODE The genetic code is the relationship between the sequence of bases in DNA and the…
Q: How understanding fish physiology be helpful in marine conservation and fisheries?
A: The term physiology relates to the study of mechanisms or functioning of cells, tissues or organs of…
Q: Identify three enzymes found in the body, their likely location inside the body, and the pH at which…
A: Enzymes are biocatalyst that perform specific chemical reaction. They are proteinaceous in nature…
Q: Use this data, and sketch a graph by hand that would best fit the data. (think which type of graph…
A: Comb jelly fish Comb jellyfish is a marine invertebrate organisms belong to phylum ctenophora.
Q: Study the diagrams below. The diagrams represent four possible phylogenetic trees showing the…
A: Principle of parsimony: The principle of parsimony is made use of when we need to determine which…
Q: what processes are most likely occurring during lag phase, growth phase (i.e., nucleation,…
A: Microfilaments are composed mainly of actin protein filaments and are essential to the eukaryotic…
Q: Which of the following statements is NOT TRUE about membrane transport? to facilitate movement of…
A: The cell Membrane or Plasma membrane is an external cell layer that acts as a selective barrier as…
Q: If one extreme phenotype makes up most of a population after directional selection, what happened to…
A: Natural selection is a selective force acting against an organism to reproduce and survive because…
Q: Which word best describes the image illustrated? P m tetrad staphylococcus Opalisades…
A: Bacteria They are prokaryotic unicellular organism which may be beneficial or harmful to human being…
Q: "The cuticle and its profound effect on the organisation and functioning of the insect body".…
A: Introduction : Insects belong to the class Hexapoda, or Insecta, which is the biggest division of…
Q: Upper Intertidal Zone Lower Intertidal Zone Balonus kalenvides Chthamalus scellatus The diagram…
A: Introduction: Connell is an American ecologist, but because his research on how interspecific…
Q: 1. A 2 kb fragment of DNA was cut by EcoRI and BamHI and then analyzed by gel electrophoresis. The…
A: The restriction endonucleus are specific enzymes that are responsible for cutting phosphoruster bond…
Q: reduces
A: C.reduce ,unfolds. Due to their covalent nature disulfide bonds can have profound effects on the…
Q: Unlike natural selection, is not related to an individual’s ability to survive and may result in…
A: Natural selection is the variation in individual survival and procreation brought on by phenotypic…
Q: The is morphological difference between bipolar neurons and unipolar neurons and that determines how…
A: As you are reading this book, think about the organs that are functioning within you right now! Your…
Q: 18. The DNA sequence M, shown below, is the sense strand form a coding region known to be a…
A: * Frameshift mutation is a mutation in which insertion or deletion of nucleotide occurs which…
Q: In a population, which individuals are most likely to survive and reproduce? (a) The individuals…
A: Population means individuals of people of the same species living in the same environment or area.…
Q: How to calculate actual size in μm
A: Three image-creation components must be considered to understand how microscopes work:…
Q: Why is it important for the sperm in internally fertilizing animals to undergo acrosome reaction at…
A: The acrosome reaction that occurs after sperm capacitation, is an exocytotic event induced by a Ca++…
Q: In a population of 50 hamsters, 60 of the alleles code for brown fur and 40 alleles code for black…
A: If the allele and genotype frequencies remain same generation after generation then we can say that…
Q: What are the distinct characteristics of the reduviid bug, tse-tse fly and sandfly
A: All the three insects belong to the Phylum Arthropoda and these are placed in the category of…
Q: If a yellow pigment was present in the extract, as indicated in the chromatogram and its absorption…
A: Pigments are the coloured substances found in plants. Pigments help in photosynthesis and give a…
Q: If a polymorphism is found at a low frequency globally, but has a high frequency in a particular…
A: Polymorphism:- it represents the two or more than two variants of a particular DNA sequences or gene…
Q: Write a note on fat soluble vitamins
A: Introduction A vitamin is an organic substance that is required in trace levels for good nutrition…
Q: What does “prezygotic” mean?
A: The processes of reproductive isolation are a group of behavioural patterns, physiological…
Q: Please answer fast Question #1: Use answers A-L to answer questions 1-6 below. They can be used…
A: Hydrogen bonds are a main characteristic of protein shape. By a usually usual definition, they…
Q: What is the purpose of soaking the egg in vinegar? Explain the rationale of vinegar reaction to the…
A: 1. What is the purpose of soaking the egg in vinegar? Explain the rationale of vinegar reaction…
Q: If the graph represents one actin filament, and line A represents dynamic activity at the plus end…
A: CapZ proteins are not present.
Q: Developing morbid obesity seems to require that individuals have a biological predisposition to gain…
A: Obesity can be transferred by gene from one generation to another generation. There have such genes…
Q: This type of cell transport happens during secretion of hormones, neurotransmitters and digestive…
A:
Q: basic structure of the subunit for each type of cytoskeletal protein and compare and contrast…
A: Cytoskeletal proteins are a group of filamentous proteins that provide structure and support for the…
Q: Put the following in order in mitosis and the preceding interphase Hint: Determine whether the event…
A: In eukaryotes, Cells divide either via mitosis or meiosis. Somatic cells divide via mitosis.…
Q: factors influencing the phenotypes of adult animals and explain.
A:
Q: + 머 B D C F E -40-4040 | 1602 ㅁㅅㅁ 거머가 40000 I ㅁㅁㅁ ㅅㅁㅅㅁㅅㅁ
A: Introduction: Autoimmunity is a situation in which the attack on one's own antigen by…
Q: One study predicted that trained subjects would have a resting metabolic rate 100-200 kcal/day…
A: The energy spent when a body performs basic functions which are required to stay alive is basal…
Q: If you are trying to set up a PCR with a total volume of 40uL and you have access to a stock…
A: Inroduction DNA replication occurs in our body. But PCR or polymerase chain reaction is a…
Q: Relate the process of genetic drift to genetic bottlenecks and the founder effect, using examples.
A: Evolution is the gradual shift in the inherited traits of natural populations over many generations.…
Q: Clarify why evolution occurs only in populations, not in individuals.
A: Evolution is the gradual change in the inherited traits of biological populations over many…
Q: If a goose with genotype Aa had migrated instead of the goose with genotype aa, would the scenario…
A: The movement of genes into or out of a population is referred to as gene flow. Such movement may…
Q: Instructions Match the letters that describe the process with the numbers in the Venn Diagram. Each…
A: Here are the matches
Q: Match the shorter sequence relative to the longer one. Note: Observe Chargaff's rule of base…
A: The DNA or deoxyribonucleic acid is the genetic material in living organisms that is composed of…
Q: Which species is the better intraspecific competitor: Lemna polyrhiza or Lemna gibba?
A: Intraspecific competition is a competition between individuals from the same species (cospecifics).…
How does the streaking of plates help you obtain single colonies?
Step by step
Solved in 2 steps
- Describe the microscopic morphology of each sample observed with the spore stain (P. aeruginosa and B. subtilis). In which of the sample can you see spores?what is the form, elevation, margin and colony color of this streak plate result?This part of the staining process helps the primary stain to remain in the cell during decolorization. O 1) Secondary stain O 2) primary stain O 3) counterstain O 4) fixing reagent O 5) mordant
- what is the physical characteristics of this streak plate? Look at a single colony on a streak plate and look for special physical characteristics such as: motility, possible presence of endospores and/or capsule, culture color?What are the circles called in the staining darkCan the gram stain be observed using a form of microscopy other than light microscopy? Why or whynot?
- what color are endospores at the conclusion of the endospore stain?On agar plate does each discrete colony represent the growth of one cell? Explain your answer. Why can a single colony on a plate be used to start a pure culture?-What are the steps of gram staining -Which of the four steps is the most important and why?- What would happen to the cells if you use too much alcohol?- What would happen if you would not use enough alcohol?- What would happen if you left out the application of safranin?