Hi! I am interested in getting some help with this question.  This spectacular animal is a Lesser Bird of Paradise, Paradisea minor, from the highlands of Papua New Guinea. In the context of various evolutionary phenomena we have discussed this semester, why do you suppose: (a) This bird is confined to New Guinea and two nearby islands? Why would you not expect to find it in the mountains of Borneo? (b) This spectacular tail presumably attracts predators; why hasn’t natural selection acted to reduce it or camouflage it?

Q: 1. DNA- CGTACGTCAGCG RNA-? Amino acid? 2. DNA- GACAGTCAGATT RNA? Amino acid? 3. DNA? RNA-…

A: 1. DNA : CGTACGTCAGCG RNA : GCAUGCAGUCGC Amino acid : Ala-Cys-Ser-Arg   2. DNA : GACAGTCAGATT RNA :…

Q: the relationship of knee height and arm span between standing height?

A: Arm span also referred as "wingspan" is described as the physical measurements of length from one…

Q: minimum edit distance

A: The minimum edit distance between two strings is defined as the minimum number. of editing…

Q: Briefly describe how the transcript beginning at the lambda PRe promoter can inhibit expression of…

A: The Cro protein is an effective and specific repressor of the RNA synthesis from the N and the cro…

Q: Analysis of a mRNA sample showed that 18% of the nitrogen-base molecules present were uracil…

A: due to time constraints we will be answering your first question here, please ask the second…

Q: Briefly explain how you can determine the presence of coliform bacteria in a water sample.

A: Coliforms are a type of bacteria. These organisms are normally harmless to the species or hosts they…

Q: Describe the virulence factors of H. pylori that allow it to colonize the stomach and survive…

A: Gastritis is a stomach lining inflammation produced by damage to the mucosal layer to prevent the…

Q: You're studying two species of closely related mice. One has a lifespan of 32 weeks, on average; the…

A: Quantitative trait loci (QTL) are genetic areas that frequently result from genetic interactions…

Q: what hypothesis regarding diversity and ecosystem function has the most support

A: An ecosystem is a community of living organisms in conjunction with the nonliving components of…

Q: 3. Now consider the following diagram, where two replication bubbles are about to meet. 5 3 Draw in…

A: The lagging strand is the one that starts to open in the 3' to 5' direction toward the replication…

Q: Distance en left her house and drove to college in the morning, as shown in the ccompanying graph.…

A:

Q: Which of the following phylogenetic trees is different than the rest? A A C BDE C EDCAB ABC DE B DE…

A: The phylogeny is the history of the evolution of a species or a group, in reference to lines of the…

Q: Compare and contrast how the endocrine and neural systems do long- distance communication within the…

A: Disclaimer: Since you have posted multiple questions, we will provide the solution only to the first…

Q: Question 38 All vertebrate animals are bipedal, amniotes chordates, mammals chordates, mammals…

A: Introduction  Animals are multicellular, eukaryotic, and heterotrophic living things. The majority…

Q: 1. You are a lead engineer in a cGMP facility that develops and delivers tissue engineering…

A: Injectable engineering solutions must be capable of supporting LV wall and avoid post myocardial…

Q: Use the following information to answer the next question. A bacterium has been found that…

A: According to Bartleby guidelines a single question or in the case of question having subparts,…

Q: Movement is a type of response to stimuli. Many unicellular organisms can move in response to…

A: Stimuli is an external input to a living organism, such as a sight, sound, smell, or touch, which…

Q: Wild type 0.09 E104K G238S --+-- 0.13 1.41 A42G G238S ‒‒‒ E104K A42G -++-- 1.41 --+-+ 362 G238S A42G…

A: Antibiotic dosing regimes could be tailored to enhance the efficacy of the drugs by being able to…

Q: The human body is composed of eleven different organ systems. Even though each system has a specific…

A: Homeostasis is any self regulating mechanism by which various biological systems tends to maintain…

Q: DNA is alway DNA mRNA 5' aal 3 51 PROMOTER AACGCATACGGGATAGCGCCCTGGTTCAAATGGCGGGCCGGCATCCC…

A: One of the core concepts of molecular biology is the flow of information from DNA to RNA to…

Q: Tell me how this image shows the relation between grape and banana

A: A phylogenetic tree's branching structure illustrates how many species or other groupings developed…

Q: Explain how is the rasberry is related to strawberry, banana and grape?

A: Pollen is a plant's male reproductive cell. It results in the development of edible fruits and seeds…

Q: which is the following is not a step in the process of de novo gene birth? o translated peptides…

A: The method through which new genes arise from DNA sequences which weren't previously genic is known…

Q: This chart shows different patterns of inheritance in four pedigrees. Assume that individuals…

A: The pedigree indicates if the DNA is passed down unchanged from generation to generation. It can…

Q: List the three events that occur during the process of photosynthesis. Explain the role of stomata…

A: Introduction  Plants absorb water (H2O) and carbon dioxide (CO2) from the soil and atmosphere during…

Q: The evolution of the highly complex eukaryotic cell was possible because.. A) Mesosomes released…

A: Correct answer is (B). Two different prokaryotic bacterial species entered the complex cells as endo…

Q: termini). What type of mutation is each? 6.a. Mutated DNA Template Strand #1: 3'-TACTGTC TGACGAT…

A: DNA It is a double helix structure that constitutes two polynucleotide chains wound around each…

Q: About 70 percent of all Caucasians can taste the chemical phenylthiocarbamide, and the remainder…

A: There is present single gene in the population. These are T and t. TT and Tt encode taster…

Q: What's the large medial area of the chest? explain in detail

A: The space between the pleural sacs of the lungs that runs the length of the thoracic cavity is known…

Q: Name and describe three mechanisms of acquired antimicrobial resistance tools that microbes may use…

A: Acquired antimicrobial resistance. The disease causing microbes  acquire resistance towards…

Q: Finally, you assess the whole skeleton for trauma and find 3 fractures and a gun shot wound. What…

A: The human skeletal system consists of 206 bones. Of these 80 bones belong to the axial skeleton…

Q: 5. A patient receives a donor kidney to replace diseased kidney tissue. Consider and answer the…

A: Cytotoxic T cells * MHC restricted * Antigen specific *Belong to adaptive immunity  * Requires…

Q: What is the mass transfer by diffusion for t:slim insulin pump ?

A: introduction t:slim insulin pump is designed by micro delivery technology.  it This product costs…

Q: A total of 2.5 x 105 cells were harvested from the patient. You need the cells to fill a scaffold…

A: The growth or culturing of cells obtained from different sources such as humans, animals, or plants…

Q: Snowy owls are large white birds that normally inhabit the cold northern regions of Canada.…

A: 1. As the food web shown in figure is interconnected, many species will be affected by introduction…

Q: Concerning interface drug reactions, which statement is false? a. Most are caused by type II…

A: Dyskeratosis: Clinically characterized by the trio of aberrant nails, reticular skin pigmentation,…

Q: Which of the following statements is false about the impacts of climate change? Choose all that…

A: Climate change is having a wide range of impacts on the environment, including increased…

Q: Why sex? The comparison of parthenogenic species with sexually reproducing species demonstrates a…

A: The "life history" of an individual organism comprises important events linked to its growth,…

Q: Predict what might happen if microorganisms began releasing methane. How will this affect the…

A: A greenhouse gas is a gas that ingests and radiates energy inside the thermal infrared range,…

Q: Can you show me a picture of raspberry and banana clade and explain

A: The monophyletic clades are those group of organisms that have a single clade in it.

Q: B. Next you isolate DNA from colonies and cut the DNA with the restriction enzymes you chose from…

A: A. As the plasmid contains ampicillin resistance gene, therefore, it confers resistance to amicillin…

Q: A 55 year old man who is overweight, a heavy drinker and habitual smoker is brought in to the…

A: Stroke : A obstruction in the blood supply to the brain or the rupture and bleeding of a blood…

Q: The next several questions refer to the data given in this problem. You sample a population of…

A: The factors that induce changes in allele frequencies over time are natural selection, genetic…

Q: "To discard the household waste we should have two separate dust-bins, one for the biodegradable…

A: The term waste refers to unwanted or unusable materials that are left behind. They are classified…

Q: The difference(s) between epithelial and single cells is that epithelia: O A. Allow absorption or…

A: Enzymes, hormones, and fluids can be secreted (released) by glandular epithelial tissue. Internal…

Q: Below is an image of the results of a gel electrophoresis experiment. Lanes 1-4 contain amplified…

A: In gel elctrophoresis, smallest DNA  fragment travels the farthest. (A) From the diagram, we can see…

Q: Explain what is meant by the concept of "central dogma of molecular biology". Name the main…

A: An explanation of the movement of genetic information within a biological system is the core tenet…

Q: How do you differentiate a nodule from a root gall?

A: Abnormal outgrowths of plant tissues and can be caused by nematodes is gall and nodule is formad by…

Q: Explain why you chose A or B, etc. Provide a logical explanation defending your answer choice.…

A: Climate changes have shown various consequences not only to the living beings but also to the…

Q: In a homeostatically regulated system, diagram or identify the regulated homeostatic variable,…

A: External substances that disrupt the generation, secretion, distribution, metabolic activity,…

Primate evolution

Primates are a relatively new species and first appeared in the fossil record nearly 55 million years ago. They may have originated as far back as the cretaceous period. Their fossils were observed in North America, Asia, and Europe. Long before the first monkeys and their prosimian relatives developed, most animal species thrived and died. The first primates did not exist until about 50-55 million years ago, even though the planet is 4.54 billion years old and the first life goes back at least 3.5 billion years. Dinosaurs had been extinct for 10 to 15 million years when this happened.