Q: Explain the process of what electrophysiology is, include some disscussion about things that…
A: Electrophysiology is a branch of biology and medicine that investigates the electrical activity of…
Q: At the end of the chromatography process you observe that the developing solution is bright green.…
A: Chromatography is a common laboratory technique for separating and analysing mixture components. It…
Q: This larger clinical trial determines whether the drug works in humans and determines the…
A: A clinical trial is a research study conducted with human participants to evaluate the safety,…
Q: The figure below represents the size of various SSRS that are used for forensic analysis. The bars…
A: Microsatellites, commonly referred to as Simple Sequence Repeats (SSRs), are brief repeated DNA…
Q: Calculate selection for the following scenario. In a population of prairie dogs living on a prairi…
A: Selection in evolutionary biology refers to the differential survival and reproduction of…
Q: DNA ligase seals the gaps between DNA fragments +RNA primers are removed by DNA polymerase I and…
A: DNA replication is a fundamental process that occurs in all living organisms, allowing for the…
Q: Each of the following describes a distinctive step in a genomic technology or experimental design.…
A: Answer.) :- Genomic technology and experimental design have revolutionized our understanding of…
Q: a study to assess the strength of selection on alleles of a gene “B” which affects brightness of the…
A: In the study assessing the strength of selection on alleles of a gene "B" that affects the…
Q: The electrons lost from the reaction center of photosystem II are replaced by electrons from ATP.
A: Photosystem II (PSII) is a key component of the light-dependent reactions in photosynthesis. It is a…
Q: If a SNP is found much more frequently in dogs with white fur than in dogs with black fur, the SNP…
A: Single nucleotide polymorphisms (SNPs) in GWAS are essential for understanding the genetic…
Q: A. One of you per group will be on his/her normal fluid intake for 24 hours prior to ingesting the…
A: Let's look at how each of the conditions will affect urine volume, urine flow, and urine specific…
Q: When blood calcium is high, the thyroid releases [Select] , and less [Select] [Select] kidneys.…
A: To answer the question accurately, you need to be familiar with the following concepts:1. When blood…
Q: You have several mutant strains of virions. Describe the replication cycle and outcome for each…
A: Understanding the life cycle of a virus, and how mutations can influence each stage, is fundamental…
Q: Assuming that a strand of DNA is not composed of equal amounts of A, G, C, and T, which of the…
A: DNA is composed of molecular structure factors known as nucleotides.These building blocks are…
Q: 1. Ethanol is a mild toxin to most living organisms and is broken down by the enzyme alcohol…
A: Nutrient absorption is a crucial process for plant growth and development. Plants require various…
Q: The following question is related to Restriction Enzymes and RFLP. Using EcoRl, how many cuts were…
A: The enzymes that are responsible for cutting double stranded DNA at a specific sequence (known as…
Q: What is a microbiome? What is the human microbiome and how is it important to human health? What do…
A: The microbiome refers to the community of microorganisms that live on and inside the human body,…
Q: 2. In a river in Ontario, 351 Atlantic salmon were captured and fin-marked with numbered anchor…
A: LetM=total marked salmonN=total population of salmonm=marked and recaptured n= recaptured
Q: A GWAS is done comparing squirrels with spots to those without. Answer the following questions about…
A: It is Manhattan GWAS plot.The results of genetic association studies are shown graphically in GWAS…
Q: The glucose in cell culture media diffuses to the cell surface where it is rapidly consumed. The…
A: Diffusion is the process by which substances or particles move from their higher concentration to…
Q: You are a physician working in a hospital. Your patient is a 65-year-old individual who has been…
A: A group of bacteria called Mycobacterium has a number of species, some of which are known to be…
Q: For the juice samples in exercise 3-4, you will be using the pour plate technique. In this exercise,…
A: In the context of conducting tests on juice samples using the pour plate technique, certain…
Q: Nancy Jones is a doctor who specializes in genetic diseases. For many years she has been studying…
A: According to the given information, unknown disease status for Nancy Jones (it is not stated if she…
Q: An agriculture extension agent is preparing pamphlets on preventing the spread of disease. In the…
A: Disinfectants are antimicrobial substances that are applied to the surface of non-living objects to…
Q: AMEL locus
A: DNA profiling, also known as genetic fingerprinting or DNA typing, is a forensic technique used to…
Q: Solvent Je ed After Ten Minutes llow one are attracted to the developing solution.
A: Thin Layer chromatography is depicted in the figure. This type of chromatography is used for the…
Q: The lining of the GI tract is called the mucosa. True False
A: The gastrointestinal (GI) tract is a long, hollow tube that extends from the mouth to the anus. It…
Q: Serum osmolality increases by about ____ mOsm/kg for each 60 mg/dL increase in serum ethanol. a. 1…
A: Serum osmolality test is used to check the fluid-particle balance in the body. It looks for chemical…
Q: arthropods
A: Arthropods:These are a diverse group of invertebrates which are characterized by their jointed…
Q: Which of the following is not a factor that increases mutations? a. Fast rates of replication b.…
A: Mutation is any change in DNA sequence that can be produced by various mechanisms and may or may not…
Q: Question 4 The following are merozygotes of E. coli with combinations of lac operon mutations.…
A: Lactose (lac) operon is an example of inducable operon. That means when the inducer (lactose) is…
Q: Does positive selection lead to formation of memory T cells while negative selection leads to the…
A: Positive selection is the process by which T cells in the thymus that bind moderately to MHC…
Q: 4 5 A 2 3 How is '1' in the above leaf anatomy image modified in a xeromorphic leaf?
A: Xerophytes are plants that are adapted to live in dry places like deserts. Example: Cactus. Since…
Q: The following reactions are all antigen(Ag)-antibody(Ab) complexes. Match the description with the…
A: Antibody-antigen reactions like precipitin and agglutination involve antibodies binding to soluble…
Q: Behavioral adaptations involve adaptations of a single organism. Question 1 options: True…
A: False.Behavioral adaptations can involve adaptations of a single organism, but they can also involve…
Q: What are the PHYSICAL/INHERITED/BIOLOGICAL traits that make us human?
A: A crucial process that adds to the variety and diversity of life is inheritance. It enables…
Q: 49. Which one below is the largest unit within which gene flow can occur based on the biological…
A: In the field of biology, the concept of species holds significant importance. It serves as a…
Q: Was the control group valid? Why or why not? 10. Were the tenets of “Informed choice”…
A: Tuskeegee experimental study was a kind of unethical study performed in the past. The study was…
Q: Consider section J, the following is a karyotype of: 75 X » ») N 5 2 3 >= X( 11 8 X 15 6 10 13 19 14…
A: *An individual entire set of chromosomes, which are grouped and organised based on their size,…
Q: Define these terms (most will Pioneer species Urbanization/urban sprawl Resource portioning…
A: Several terminology are used in the study of ecology and community dynamics to help us understand…
Q: Which of the following terms is an absolute condition? Degermation Disinfection O Sanitization O…
A: In various fields, such as healthcare, food processing, and laboratory settings, ensuring…
Q: It took a temperature of 135 degrees Celsius to kill all of the bacteria in a test tube in 10…
A: As more and more microbes were discovered and identified to be the cause of various infections or…
Q: What proteins are crucial for creating and maintaining DNA replication forks? Choose the best…
A: Replication in the process in which double stranded-DNA is duplicated or copied to produce two…
Q: Based on the information on page 147 Choose the best response. Lactobacillus bulgaricus O…
A: Yogurt, a widely-consumed fermented dairy product, owes its unique taste and texture to the specific…
Q: a) Bioinformatics is an interdisciplinary field that integrates computer science with mathematics…
A: Genomic research is aided by using bioinformatics tools like BLAST (Basic Local Alignment Search…
Q: Another mutant for of the Lac promoter demonstrates the characteristics below compared to the…
A: One plausible explanation for the observed data is that the mutant Lac promoter has a structural…
Q: MUTATION-BASE SUBSTITUTION Change the 14th base of the DNA to guanine "G". Construct a new, mutated…
A: Q.Ans:- A mutation is an event where the DNA sequence gets changed as a result different types of…
Q: A (Only zygotes with balanced genomes will survive to adulthood. What proportion of F1 zygotes have…
A: A unique organism with an intriguing genetic configuration evolved from a population of Drosophila…
Q: Calculating the final magnification of the specimens. The size of any specimens is very important…
A: During labeling and recording, the estimate of each example is critical. As a result, we must…
Q: microscopic methods
A: Microscopic methods:These are the methods which refer to various techniques and instruments used to…
Nucleotides
It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid).
Nucleic Acids
Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.
Step by step
Solved in 3 steps
- 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’ and 3’ directions appropriately on the mRNA, feel free to rewrite the DNA strand if needed to make it easier to interpret. Make sure to label the mRNA with a "5'cap" and place 10 A's to form the poly-A tail.5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this geneFirst Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…
- PLEASE FL OUT TABLE USING INSTRXUTIONS -USE BASE PAIRING RULES TO COMPLETE SECOND COLUMN FOR EACH MUTATION WRIYE IN ANY MRNA DOEONS RHAT WILL BE FHANGED AS THE REEULR OF RHE MURATION AND USE X MARKS RO INDÍCATE DOONS THAT WONT BE FHANGES CIRCLE STOP CODONSMutated DNA Sequence #4 ТАСАС СТTGG CGACT АСТ... What's the mRNA sequence? (Circle the change) amino acid sequence? Will there likely be effects? What type of mutation is this?48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
- Name: Date: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this s sequence into MRNA. er bns eldst eboo oi ebitqeqylog erlt to noihiog eri qu elsm bluow tsri abios onime Jlaw as ye s 1ot noitem atelomet AHG 3. The following MRNA ştrand is being used to asemble a polypTemplate strand: 5' AATCATAACTCATTG 3' A. Write the CODING strand of this sequence, including the 5' and 3' end designations. B. Write the amino acid sequence coded by this mRNA. The start codon is the first codon in the sequence that codes for Met. First position (5'-end) U < G บบบ UUC phe UUA UUG CUU Couleu CUC Coc CUA CUG AUU AUG AUC ile GUU GUC GUA GUG Second position C UCU UCC UCA UCG val CCU co CCC CCA 000 CCG ACU ACC ACC AUA ACA thr AUA ACA AUG met ACG GCU GCC ser GCA GCG pro ala UAU ORD tyr UAC UAA Stop UAG Stop CAU CAC CAA CAG - AAU AAC www AAA 10 asn AAG 7 his GAU GAC GAA GAG gin }| lys asp glu UGU UGC cys UGA Stop UGG trp CGU C00 CGC CGA 000 CGG AGU AGC ACA AGA AGG GGU GGC GGA GGG Initiation Termination arg ser arg gly DUAL SUAU DUAU DUAG Third position (3-end)Mutated DNA Sequence #1 TACAT C TTG C G A C GAC T... What's the mRNA sequence? (Circle the change) amino acid sequence? Will there likely be effects? What type of mutation is this?
- Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C TWhat’s the mRNA sequence?What will be the amino acid sequence?What kind of mutation is this?Will there likely be effects?Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C T What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What kind of mutation is this?