During cellular respiration, energy is released from food. What else does the cell need for this process to take place O A. carbon dioxide O B. oxygen O C. sunlight O D. nitrogen
Q: 1. ________ is the number of ATP produced when there is no oxygen available. 2. The final molecule…
A: According to the question, we have to find out the number of ATP produced when there is no oxygen…
Q: There is a toxic metal that can puncture the outer membrane of the mitochondria which creates a gap…
A: The outer membrane is the gateway to the mitochondrion, just like the cell membrane is for the cell.…
Q: Chloroplasts plays an important role in: O A) Organizes and moves internal parts of the cell. O B)…
A: Cell is the smallest structural and, functional unit of life. It is simple machinery that houses all…
Q: Which is NOT a characteristic of mitochondria? They: A) have two membranes. B) are the site of…
A: Organelles are the specialized structures that perform various jobs inside the cells. The term…
Q: cancer cell metabolism is different from normal cell metabolism
A:
Q: What is the result of cellular respiration? OA Energy for cell processes is released. Oxygen is…
A: In all living species, cellular respiration takes place within their own cells. In a cell, there is…
Q: What is the function of the cell membrane? To control the substances that enter and leave the cell O…
A: Introduction :- The cell membrane, also known as the plasma membrane, is found in all cells and…
Q: The majority of adenosine triphosphate (ATP) needed by the cell is produced by thea. nucleus. b.…
A: Answer is c.) mitochondria.
Q: On a nice cool day, you decided to take a deep breath in and breathe out and saw a fog that formed…
A: Cellular respiration helps the cell to generate energy needed and get rid of water and other waste…
Q: Choose A=if statement 1 and statement 2 are both true, B=if statement 1 is true but statement 2 is…
A: Asked : Correct Option regarding given statements
Q: The mitochondria of a eukaryotic cell is the site ofa. photosynthesis.b. fatty acid metabolism.c.…
A: Mitochondria is a membrane-bound organelle in eukaryotes which is referred as powerhouse of the…
Q: Why is it important for humans to prevent body temperature from rising above 45 C? a. This…
A: Homeostasis refers to the ability of the biological system to maintain a stable internal environment…
Q: Newly made proteins are modified in which organelle? O A. mitochondrion O B. ribosome O C. nuclear…
A: Cell organelles are defined as specialized structures found inside a particular type or form of cell…
Q: All of the chemical reactions that occur in a cell are calleda. homeostasis. b. metabolism.c.…
A: Biochemical reactions is the transformation of one molecule to a different molecule inside the cell…
Q: Smaller cell is: A less active metabolically B with larger nucleus C with…
A: Different cells would have different levels of metabolic activity depending upon the function the…
Q: Mitochondria Contain ___________ Located in the Matrix
A: A cell is the basic structural and functional key of life. A cell has multiple organelles that carry…
Q: he largest cell organelle is A. nucleus B. endoplasmic reticulum C. chloroplast D. mitochondria
A: The cell theory states that every one biological organism is composed of cells; cells are the unit…
Q: Which of the following statements about extracellular enzymes is FALSE? Question 1 options: A…
A: Exoenzymes, also known as extracellular enzymes, are enzymes that are produced by a cell and act…
Q: Mitochondria produce which of the following? A. ATP B. DNA C. RNA D. proteins
A: Answer :- Option A correct, Mitochondria which is produce ATP (adenosine tri phosphate) ATP are…
Q: Exergonic reactionsa. release potential energy b. consume energy c. form bonds d. occur only outside…
A: Biological processes are processes that are crucial for all living organism to live and are composed…
Q: Each of the following statements concerning mitochondria is true, EXCEPT a.The mitochondria require…
A:
Q: cellular respiration is harvesting cell energy from_____. It is the changing of _______ bond energy…
A: Food contains complex biomacromolecules that need to be converted to a simpler form. The body can…
Q: The energy currency of the cell is A. starch. B. glycogen. C. glucose. D. ATP.
A: Cell is the basic structural, functional and biological unit of all known organisms. They are often…
Q: Two locations where substrate phosphorylation occur in the cell are the… A. cytosol…
A: Phosphorylation involves the transfer of phosphate group forms the substrate to another organic…
Q: list the four steps of cellular respiration and where they take place in the cell.
A: Cellular Respiration is the process which can be defined as a process through which the the fuel is…
Q: If oxygen is more concentrated outside a cell than insidea). the oxygen will tend to diffuse out of…
A: Introduction:- Diffusion is the net movement of a substances from an area of higher concentration…
Q: Which organelle of a cell is where respiration takes place? O A. chloroplast O B. mitochondrion OC.…
A: Mitochondria: Mitochondria are double membrane-bound cell organelle and they also contain double…
Q: • What is cellular respiration? • What are the three processes involved in cellular respiration?…
A: What is cellular respiration? Cellular respiration, the method by that organisms mix oxygen with…
Q: Two locations where substrate phosphorylation occur in the cell are the A. Cytosol B. Chloroplast…
A: A metabolism reaction which results in the production of ATP or GTP by the transfer of a phosphate…
Q: The primary function of mitochondria is A. protein breakdown B. fat synthesis C. release of hormones…
A: Mitochondria are energy-converting organelles and therefore, also known as the power house of the…
Q: Discuss the effects of the following factors in the rate of cellular respiration: a. temperature…
A: Cellular respiration is a series of sequential events that takes place inside a cell, which produce…
Q: The part of a mitochondrion that has a high concentration of hydrogen ions (protons) in a respiring…
A: Mitochondria (singular: mitochondrion) play a critical role in the generation of metabolic energy in…
Q: The movement of gases across membranes in the lungs is Select one: a passive process caused by…
A: In a process called diffusion, oxygen moves from the alveoli to the blood through the capillaries…
Q: Cellular respiration
A: Cellular respiration is divided into 3 phases, glycolysis, krebs cycle, oxidative phosphorylation…
Q: Where does glucose 1-phosphate in the liver get converted to glucose before it is transported to…
A:
Q: The end goal of cellular respiration,________ is the energy molecule of the cell.
A: Respiration is a catabolic process through which respiratory substrates such as carbohydrates, fats…
Q: Cellular respiration uses carbon dioxide and water none are correct releases energy as ATP results…
A: Introduction :- Cellular respiration is a process by which glucose ( sugar) is converted into…
Q: The molecule that each cell uses as fuel to directly power its cellular processes is called: Glucose…
A: Cellular processes is necessary for the survival of an individual. The cellular process are…
Q: what are the primary cellular sites for the production of ATP? O1. endoplasmic reticulum O 2.…
A: Introduction ATP (adenosine triphosphate) is an energy-carrying molecule found in all living…
Q: The breaking of the bond to the last phosphate group of ATP releases energy that can be used by a…
A: Energy is liberated when the ATP breaks into ADP and inorganic phosphate. ATP consists of 3…
Q: _____________ occurs within mitochondria. a. fatty acid synthesis b. β-oxidation c. VLDL synthesis…
A: _____________ occurs within mitochondria.a. fatty acid synthesisb. β-oxidationc. VLDL synthesisd.…
Q: Which component of the electron-transport chain is NOT an integral membrane protein? O a. Complex…
A: Electron transport chain or ETC is a pathway in which a series of electron transporters are present…
Q: Where does decarboxylation in the Kreb’s cycle take place? a.) cytoplasm b.) intermembrane space…
A: Decarboxylation Decarboxylation is a chemical reaction where carboxyl group is removed from the…
Q: Which of the following characteristics do not occur in prokaryotic cells? A Cellular organization…
A: A cell is the basic structural and functional key of life. A cell has multiple organelles that carry…
Q: Mitochondria are responsible for ____________ and _____________ production of the cell while…
A: Mitochondria Mitochondria is a double membrane bound organelles found in cytoplasm of eukaryotic…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- Topic: 2.1 Discussion Forum + https://ftccollege.instructure.com/courses/20120/discussion topics/272565?module_item_id=1000471 2024 04C April (4/1/2024) me abus mouncements This is a graded discussion: 100 points possible 2.1 Discussion Forum BA✩ due Apr 9 34 34 dules ades ople BlueButton ar Deck Tutoring The Medical Receptionist Instructions The role of the medical receptionist includes knowing and understanding a wide variety of laws and regulations, answering an almost constantly ringing telephone, reviewing insurance cards, determining insurance types or managed care plans, entering demographic data into the computer, posting a variety of transactions, scheduling appointments, and professionalism. In other words, the receptionist at a medical office should be a professionally trained medical assistant who is flexible and prepared for a variety of duties. . What are at least three important skills that you should have when working at a medical front desk? Explain why you think these…II Log In x b My Que X d.cuny.edu/webapps/assessment/take/take.jsp?course_assessment_id%3 2077934_ 1&course_id%3 2021853 18content id 62810464 18 Remaining Time: 1 hour, 31 minutes, 54 seconds. * Question Completion Status: Moving to the next question prevents changes to this answer. Question 2 AAGTCAAGAAGAAGAAGAAGCC A. The nucleotide sequence above is a STR of how many repeats? B. What sequence is being repeated? For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac), TTTArial 3 (12pt) E: - L ^ The nucleotide sequence5 above is 5 The sequence being repeated is AAG I 41°F e here to searchlogy 9 Grades | Schoology 9 Schoology i bcps.schoology.com/common-assessment-delivery/start/4564693659?action=onresume&submissionld=354397431 Downloading SIM.. M Gmail D YouTube pt Maps S Watch Disney Chan.. 1/14 Show What You KnoW 2 of POSSIBLE POINTS: 3.33 The reaction in the Candy Shop video shows the reaction between sugar and sulfuric acid. This reaction v an example of a chemical reaction. 1 前Review O 19 0 10 1123 12 O13O 15 fo 30 17 C0 (e
- R Chen 109 Lectures CpX + ecollege.com/course html courseld17809178&OpenumHMAC-a1cb6af2a694560835408ac3c7#10001 Propiem 2.37 - ENnanced with reedback A brain scan uses the radioisotope oxygen-15. The recommended dosage is 60 mCi. A supply of 250 mCi in 20 mL arrives at the lab. to search N 2 W S 3 X E All D S с R F S V T G 6 B Y H & 7 N J 8 Part A Home Provide Feedback 1 M How many m.I, will be injected into a patient? Express your answer to one significant figure and Value Submit K ( 9 End O Request Answer PgUp 0 Units Alt Pwand PgDn O 98 Up ?* My Home Content Take Test: Unit 1 Exam - BIOS x Q chapter 24 Flashcards | Quizle x O New Survey - UIC Healthchec X A uic.blackboard.com/webapps/assessment/take/take.jsp?course_assessment_id=_395458_1&course_id=_200855_1&content_id=_9051211_1&question_num_3.x=0... Apps Яндекс.Переводчи.. O Part-Time Lecturers. A Google Maps تمارين صعبة ولكنها ا. . . ي الشيخ عبد الباسط ع. .. رجيم كامل يحق ق التنح.. الزنجبيل وال ليمون أهم. . . E Reading list Remaining Time: 5 minutes, 42 seconds. * Question Completion Status: 12 Kauai Picture-winged Drosophila Oldest island Oahu Maui complex 40 - Youngest island 26 Hawaii © 2001 Sinauer Associates, Inc. Examine the figure above. Arrows represent times that an ancestral species of Drosophila moved from one island to another and underwent a speciation event. This movement promotes what kind of speciation? O Morphological speciation O Allopatric speciation O Ecological speciation O Sympatric speciation P Type here to search 5:13 PM 73°F O G 1x ENG 74…1 NICATIONS 6 Colaborate LJ eting 3 ce zing Tutoring al Office Hours d & iCAN Help Is https://bsuonline.blackboard.com/webapps/assessment/take/launch.jsp?course assessment_id= 179293_18course_id= ype here to search ✩ Question Completion Status: 3 b. 1921 by Banting and Best QUESTION 1 Insulin was discovered in what year and by whom? O a. 1953 by Roswell O c. 1945 by Henderson O d. none of the above QUESTION 2 QUESTION 3 4 O 19 What percentage of all cases of diabetes mellitus is accounted for by type II DM? O a. 10% Ob. 90-95% O c. 15% O d. 99% 100 C L 5 L 11 C 12 13 14 6 15 4+ 16 8 L 144 L
- G The lirst step in the X Ouizzes 202 a Amazon.com ShopX E Take Test: Quiz 4- Ô https://bbhosted.cuny.edu/webapps/assessment/take/take.jsp?course_ assessment_id%= 1954194_1&course_id=_2 Remaining Time: 15 minutes, 52 seconds. * Question Completion Status: 11 12 15 4. 7L A Click Submit to complete this assessment. Question 15 Match the following categories of microscopic observations of RBCS with the appropriate example. variation in RBC color a. Howell-Jolly body y alteration in RBC size b. hypochromia v alteration in RBC shape c. schistocyte v an RBC inclusion *d. macrocytes A Click Submit to complete this assessment. O Type here to search DELL1.6 Assignment - с Login to Student Po..... Pa N ccount ashboard Courses Calendar Inbox History 21 Help & FI 2 @ ftccollege.instructure.com/courses/18672/assignments/455374 S the textbook: Dr. Winston Lewis's patient, Annette Samuels, has come into the Inner City Health Care clinic complaining of lower abdominal cramps and diarrhea. After discussion of her symptoms and a brief examination, Dr. Lewis's clinical diagnosis is an intestinal parasite infection. She asks Gwen Carr, CMA (AAMA), to obtain a stool sample from the patient. The sample will be sent to an outside independent lab to see if the parasite or its eggs can be visualized. This is called an ova and parasite test or O&P. Email | Microsoft 365 Type here to search Gwen is sensitive to Ms. Samuels's level of understanding as she gives her specific instructions on how to obtain the needed sample. She asks Ms. Samuels if she has questions, and she has Annette repeat the instructions to be sure she understands them. When Ms.…est on X C pps Hb About tx * Question Completion Status: Hb Reassess X fn S 1.50 Secure https://blackboard.le.ac.uk/webapps/assessment/take/launch.jsp?course_assessment_id=_39582_1&course_id=_41417_1&content_id=_3500175_1&step=nu Unavailable in you... Amazing Opportu... Palmar Oceanfron... Iv Bag, Medical Dr... JD Fila Disruptor II R... A 2.0kb bacterial plasmid 'BS1030' is digested with the restriction endonuclease Sau3A; the plasmid map is depicted in the diagram below and the Sau3A (S) restriction sites are indicated. The DNA marker used is the 50 bp ladder, which consists of 10 DNA fragments of 50 bp, 100 bp, 150 bp, 200 bp etc. up to and including 500 bp. Which of the following four DNA samples (1-4) on the gel above indicates plasmid 'BS1030' fully digested with Sau3A? a. Sample 3 b. Sample 2 c. Sample 4 d. Sample 1 shift tab Bb About tx Bb Practica x * Log In | X caps lock Plasmid BS1030 2.0 kb S 1.10 S 0.00/2.00 esc control PROK - S 0.25 A S 0.45 alt $ 0.55 option 2 Click Save…
- x Show What Yx bcps.schoology.com/common-assessment-delivery/start/6343073370?action Messages | Sx Google Meet BCPS Links 6 bcps.schoolo X When oxygen levels are high, the body can use Directions: Fill in the blanks below in the lab summary by dragging and dropping the words/phrases to their correct position. to the cells for this process to occur. Therefore, Show what you know: Aerobic and Anaerobic Cellular Respiration (minor summative) :: aerobic cellular respiration Schoology x Grades | Scho x 6 onresume&submissionid=974031692 the "go to" method of obtaining ATP because it produces a byproduct of :: oxygen 6 Schoology will occur to produce to get energy. But when exercising intensely, your body will not be able to provide enough :: anaerobic cellular respiration :: energy x This byproduct is known for causing! 6 Show what yox + for the body. This process is not #lactic acid :: muscle fatigue O 4 1 Sign out 2 Nov 15 20 B K 2 B C Review 2:25 O @ X US 8VOLTE OD 271+ 9:45 f Q2 Health Activity... Activity 2: WMhat's the Questinn? Instruction: For each answer, create the correct question. The information you need is in the chart. We've done the first one for you. Step 1: Download the Photo. Step 2: Answer by edting the same Photo. Step 3: Upload in the same Activity. There might be more than one right question for some answers. Answer 1: Drugs are sometimes injected. Answer 2: Cigarettes belong to the socially accepted drugs category. ....... ------------ .. Question 1: Question 2: Answer 3: A street name for this drug is Answer 2: "Energy drinks contain stimulants Mary Jane. Question 3: Question 4 Answer 2: Halkcinoger's short term effect include altered perception. Question SA A A ADO J NO ô F17% 7:26 PM 7:26 PM DDM. Unit 2 Discussion Board lec prod.moonami.com S FLORIDA CAREER COLLEGE 9 BETTY VOLTAIRE Write a 150 words for your initial response. Your first response is due by midnight of the second day of the unit. Provide links to the resources you used to conduct your research. You must respond to at least two other classmates on a separate day by midnight of the last day of the unit for full credit. While you can be supportive of your peers by saying. "I agree" or "Wow, I never thought of that", these statements alone are not sufficient, you must explain why. Any posts made after the last day of the unit will not be considered for a grade Answer the question(s) below: After Reading Chapter 22 in Mosby's Nursing Assistants, please submit your answer to he following question Ás you check one of the persons to whom you are assigned in the nursing center, you observe that the person has had an incontinent stool. How will you explain to the person what needs…