Discuss how mutations in the 5’ splice site, 4’ splice site or branch point of an intron may disrupt RNA splicing and what the effect may be on the phenotype
Q: Summarrize the laws and policies that relate to the practice of agricultural and biosystems…
A: It was An Act Strengthening, Modernizing and Aligning the Practice of Agricultural Engineering in…
Q: Discuss the significance of the Hardy–Weinberg principle as it relates to evolution and list the…
A: In the absence of disrupting events, the Hardy-Weinberg equilibrium implies that genetic changes in…
Q: How do studies of brain development in knockout mice support the statement that apoptosis is a…
A: Apotopsis is a process of programmed cell death. It is a process in which the cell division is…
Q: Table I. PHENOTYPE/GENOTYPE DETERMINATION TRAIT YOUR PHENOTYPE YOUR GENOTYPE(S) Darwin's Ear Point…
A:
Q: Why is mutation important to evolution if it is the microevolutionary force that generally has the…
A: Microevolution is the evolution that acts on a small population or in a single species and it is…
Q: What is the genetic significance of mitosis (I.e., how do the daughter cells compare to the original…
A: Mitosis is the equational division, which means at the end of this type of cell division, two…
Q: Agglutination is used only in vivo. to detect bacterial diseases. often as a substitute for…
A: Agglutination refers to the clumping of cells due to result of aggregation between antigen and…
Q: List the differences in the loading of the tRNA and its alignment with the mRNA between the…
A: Translation It is defined as the process of translating the sequence of mRNA molecules to the…
Q: Explain the concept of Making a Transgenic Animal: The Basics ?
A: The production of transgenic domesticated animals has the potential to significantly improve human…
Q: State any five objectives of biological classification.
A: Introduction In this question we will discuss about the objectives of biological classification.
Q: Some eukaryotic promoters contain an element positioned around nucleotide +1 called a…
A: The transcriptional initiator (Inr) for mammalian RNA polymerase II is a DNA sequence element that…
Q: 5' AUGAGGAUGGCCAGUCAAUUUGA 3' 5' AUGGAUGGCCAGUGCAUUUGA 1. Missense 3' 2. Silent 5'…
A: Frameshift deletion occurs when one or more than one nucleotide in a nucleic acid is removed,…
Q: Although most salamanders have four legs, a few species that live in shallow water lack hind limbs…
A: Natural selection refers to the evolution of species in such a way that the changes are better…
Q: Meiotic double strand breaks are repaired by SPO11. * True false
A: Meiotic recombination is the process of reciprocal exchange of genetic material (DNA) between the…
Q: Post-transcriptional modifications in eukaryotic RNAS A. addition of CCA at the 5'end of the TRNA…
A: Answer :- Option (D) is correct. - Addition of CCA at the 5'end of the tRNA for binding with amino…
Q: uestion 15 aly eukaryotic transcription enzymes will synthesize small nuclear RNA molecules involved…
A: Transcription is the process in which RNA is synthesized. The main transcription enzyme is RNA…
Q: Name 2 sources of variation produced during meiosis.
A: Meiosis is a form of cell division in which the reduction of the number of chromosomes to half…
Q: Some transcription factors need to bind to the DNA directly and others to the enzyme to recruit it…
A: This question is based on transcription process in the cell.
Q: differentiate founder effect from bottleneck effect.
A: The two types of genetic drift are founder effect and bottleneck effect. Both, in the form of…
Q: 1.Find the ear of corn marked Dihybrid Testcross. This ear represents the offspring of the cross…
A: NOTE- since you have posted multiple questions so we will be solving the first question for you. If…
Q: Besides the size and position of the centromere, what is the same about these?
A: *Chromosomes are thread like structures located inside nucleus which is made of protein and a…
Q: Describe ONE likely mechanism of action of a caspase inhibitor. Explain why an inhibitor for…
A: Caspases are expressed inside cells as inactive precursors that must be activated in order to cleave…
Q: Lola Fe is 80 years old. She claims that she’s been getting shorter every year, and that soon she’ll…
A: Different bodily changes occurs due to the increase in age. The height is a factor which is…
Q: When acetyl-CoA containing radioactively labeled carbon atoms is fed to cells, the CO, produced is…
A: Krebs cycle is the cyclic process, occurring in the mitochondrial matrix of living cells. where…
Q: What is single molecule sequencing in real time (SMRT) ?
A: DNA sequencing is a technique for determining the order of the four nucleotide bases found in DNA:…
Q: Define about dideoxynucleotides (abbreviated ddNTPs) ?
A: The genome of an organism is defined as the entire genetic information that is passed down from…
Q: Distinguish between mitosis and cytokinesis. What are the results of each?
A: Mitosis and cytokinesis in cell.
Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…
A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…
Q: One of the termination mechanisms in bacteria utilizes the_factor that is an ATP-dependent helicase.…
A: Prokaryotes like bacteria uses a prokaryotic protein in the termination of transcription. It is an…
Q: 1 2 3 4 5 6 7 8 ii %3| 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y The image has a non-disjunction…
A: The given image depicts the presence of an extra Y chromosome. The condition is 47XYY, called…
Q: The nematode C. elegans has proved to be a valuable model organism for studies of cell birth, cell…
A: Caenorhabditis elegans is a nematode worm that is used as a model organism to study cell…
Q: Discuss the eukaryotic transcription process and mention the enzymes and components needed in the…
A: Cell is the basic structural and functional unit of life. All cells contains nucleus within which…
Q: What is the relationship of osmosis to enzymatic browning?
A: Enzymatic browning is a process of food turning brown in color.
Q: Parent Cross: Blue-Eyed Male x Normal Female Blue-Eyed Female F1 Offspring Normal Male Normal Female…
A: Drosophila melanogaster. The position of the white eye gene, positioned at the x-chromosome of this…
Q: Which strand below would be the complementary strand for the sequence AAACGCTT O GGGTATCC O AAGCGTTT…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Q: What is gene targeting? Give some examples of gene targeting?
A: Gene is a stretch of DNA in a chromosome which codes for a functional product either in the form of…
Q: Ridge endings, Bifurcations, enclosures, and other ridge details are known as: Group of answer…
A: ANSWER;- Ridge characteristics Explain;- - Ridge characteristics are edge endings, bifurcations,…
Q: Q1 The cell shown in the diagram has been magnified 3000 times. The diagram is 21 mm wide. What is…
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: In prokaryotes, the sigma factor recognizes base sequences in the _____ which facilitates RNA…
A: Answer - promoter
Q: Which microbiology test measures the use of LACTOSE? What color is positive in each?
A: Lactose is a naturally occurring sugar present in dairy products such as butter and desserts.…
Q: Under certain abnormal conditions, one type of epithelial tissue may undergo transformation into…
A: Introduction The epithelium is a type of body tissue which is consists of cells that form membranes,…
Q: Why do signals indicating damage to cells result in increase in the expression of p21Cip1?
A: Cell cycle progression is tightly controlled by cyclins and cyclin-dependent kinases (CDKs), the…
Q: Can you describe a scenario in which public health and safety might be threatened by food crops…
A:
Q: provide an example of a clinical scenario where a Type A patient has wild type A alleles at the ABO…
A: The ABO blood grouping is controlled by an 'i' gene. This gene has two alleles iA and iB. Both these…
Q: Do all reflexes require sensory inputs from the same muscle bundle?
A: Introduction Sensory input is the stimulation of a sense organ, causing a nerve impulse to travel to…
Q: (b) Describe the role of invariant chain, CLIP, HLA-DM in the antigen presentation process.
A: Invariant chain plays important role in functioning of MHC class II molecules.
Q: All about splicing A. snRNPs interactions will bring the 5' and 3' splice sites together in the…
A: Removal of intron sequences is splicing.
Q: Discuss the problem that there still is too many people that have diabetes link it to type 2…
A: People with type 2 diabetes have difficulty using glucose (sugar) from food as energy. After a meal,…
Q: In order for transcription to begin, the DNA-duplex must be "opened" to allow RNA polymerase access…
A: *To begin the transcription DNA duplex must be opened to allow the RNA polymerase to unwound segment…
Step by step
Solved in 2 steps
- Discuss how mutations in the 5’ splice site, 3’ splice site or branch point of an intron maydisrupt RNA splicing and what the effect may be on the phenotype.Which of the following statements about the mechanism of splicing is correct? 1. A mutation in a 5' splice site will always lead to a shorter mRNA. 2. Mutations in a non-splice site (for example, middle of an intron) does not affect the protein. 3. snRNPs at a 5' splice site can recognize and bind to snRNPs at another 5' splice stie. It is possible that a mutation in a splice site can lead to the removal of an exon. 4. A. 1, 2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only O E. All of 1, 2, 3 and 4 are correct.Draw the SMN2 pre-mRNA (10 exons and 9 introns), indicate the 5’ and 3’ SS location. Draw the SMN2 mature mRNA before treatment with Spinraza. What type of alternative splicing is occurring? Draw the SMN2 mature mRNA after treatment with Spinraza
- The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never madeIS. Alternative splicing has been estimated to occur in more than 95% of multi-exon genes. Which of the following is not an evolutionary advantage of alternative splicing? Alternative splicing increases diversity without increasing genome size Different gene isoforms can be expressed in different tissues Alternative splicing creates shorter mRNA transcripts Different gene isoforms can be expressed during different stages of development.
- Explain how each of the following processes complicates the concept of colinearity. Q. Trans-splicingSelect the three post-transcriptional modifications often seen in the processing of mRNA in eukaryotes: Group of answer choices heteroduplex formation; base modification; capping 3'-capping; 5'-poly(A) tail addition; splicing 5'-poly(A) tail addition; insertion of introns; capping removal of exons; insertion of introns; capping 5'-capping; 3'-poly(A) tail addition; splicingThe diagram, shown in attatched image, shows an mRNA that is alternatively spliced. The alternatively spliced variant contains Exon 1, Exon 2, and Exon 4. Indicate below if a splice site is used, blocked by a modifying protein such that the spliceosome must choose a different site, or skipped to make this alternatively spliced variant.
- The U1 splice donor site is critical for positioning of the U1snRNP for appropriate splicing. What site/region(s) participates directly in the phosphoester bond exchange that forms the lariat leading to the correct excision of the intronic segment? Options: the branch point adenosine the poly A stretch within the intron (high conservation ~80%) U2AF binding site (GU) at the 3' intron/exon junction a and b only a, b and cA eukaryotic protein-encoding gene contains two introns and three exons: exon 1–intron 1–exon 2–intron 2–exon 3. The 5′ splice site at the boundary between exon 2 and intron 2 has been eliminated by a small deletion in the gene. Describe how the pre-mRNA encoded by this mutant gene will be spliced. Indicate which introns and exons will be found in the mRNA after splicing occurs.Splicing machinery must recognize three portions of the precursor RNA molecule: the 5’ splice site, the 3’ splice site, and the exon junction complex (EJC). True or false