Design 6 bp primers to amplify the region of this sequence that is highlighted in yellow. 1 attatatttt atattatata ctctgggctc agagcagccc 40 41 atattatata tatatatttt aaaatattat aaatttattt 80 81 cagtcacgcg tcctgatgac attatatttt ataatttttt 120 121 ttttattttt attatatttt aaaatattat aaatttattt 160 161 aaaatattat tatatattta aaatttattt attataaaat 200 201 aaaatattat ttttattttt gagatcagga cggctgcatg 240 Forward primer Reverse primer

Q: Which of the following is NOT true of spread plating method? A. the maximum inoculum allowed is 1.0…

A: Please follow step 2 & 3 for detailed explanation.

Q: need help finding the right answers  there are mutiple answers please

A: In a coelomate, the lining of GI is different from the lining of internal organs and hence the first…

Q: What is mutualism? Look up some examples of relationships that have been identified as mutualisms,…

A: Population interaction is a very important phenomenon in the world. Organisms are interacting with…

Q: Based on his phenotype muggle, with the information provided, can we tell what Dudleys second allele…

A: Inheritance or heredity is passing-on one trait from the parents to the progeny by either asexual or…

Q: In what phase of bacteria population growth is Penicillin most effective and why?

A: Introduction:- The bacterial cell cycle involves the replication of DNA and the partitioning of…

Q: dysregulation/impaired function for each of these. Hypothetically, how can you rescue the…

A: G protein coupled receptors is a trans membrane domain of 7 helix meaning that they cross the cell…

Q: Pathogens have a variety of traits that interact with a host and enable the pathogen to enter a…

A: A pathogen is an organism that is capable of causing disease in an organism. It is also known as an…

Q: Template strand/Sense strand Coding strand/Antisense strand Region of DNA unwinding Region of DNA…

A: The sense strand, or template strand, is the only strand that is effectively employed as a template…

Q: Sickle cell 1). how many people does it affect? 2) Is it genetic and if so what chromosome is the…

A: Sickle cell Sickle cell or sickle cell disease (SCD) is a rare genetic disorder in which the red…

Q: Why are viruses considered “obligate intracellular parasites”?  What does it mean to be “obligate”?

A: Introduction :- Intracellular parasites are microscopic parasites that can grow and reproduce inside…

Q: Determine the risks and ethical issues associated with nanotechnology

A: Nanotechnology- The term given to those areas of science and engineering where phenomena that take…

Q: A 43-year-old man is diagnosed with chronic myeloid leukemia (CML) and started on standard imatinib…

A: Man with Chronic myeloid leukemia treated with imatinib therapy :-

Q: 1. List bacteria, yeasts, and molds (two of each) associated with spoilage of vegetables and fruits.…

A: Answer :- Spoilage of vegetables and fruits occurs due to their low pH i.e, less than 4 microbial…

Q: A python can survive by eating a large meal once or twice a year. When it does eat, microvilli in…

A: Pythons are commonly found in Asia, Africa and Australia. They belong to the Pythonidae which is a…

Q: How are squalus (shark) brain and sheep brain similar and different? Please avoid copying the…

A: Squalus It represents the genus of dogfish sharks which belong to the family of Squalidae. These…

Q: 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template…

A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…

Q: Double fertilization results in __________________________. a. a diploid zygote and triploid…

A: In flowering plant reproduction, double fertilisation is the union of the egg and sperm, as well as…

Q: Biotransformation. Explain the process of enzyme induction. What are the benefits or down-falls of…

A: Enzymes are proteins that increase the rate of chemical reactions by lowering the activation energy…

Q: Name the three divisions (parts of the ear).

A: We will answer the first question as exact one question is not specified. Please send back the…

Q: Narrow spectrum Penicillin act on

A: Penicillins is a group of antibiotics which is mainly obtained from penicillium moulds like…

Q: Order the following structures of the kidney in the sequence in which fluid passes through them on…

A: The kidneys are two reddish bean-shaped organs on either side of the spine, lying below the rib…

Q: Where is dentin matrix phosphoprotein expressed?

A: Dentin is mostly made up of hydroxyapatite crystals that are suspended in an organic matrix. This…

Q: A previously healthy female patient presents with fatigue and insomnia. An examination shows she is…

A: Option C is answer    Reason:-    The hematocrit value is defined as the measurement of the…

Q: What is an introduction to immunology and immunopathology?

A: The immune system is comprised of various cellular and humoral elements such as T, B-lymphocytes,…

Q: Explain from the standpoint of relatedness, that there is no reason to think that either bonobo…

A: Humans are apes, and they share a number of features with nonhuman apes. The social construct is one…

Q: How does intermittent fasting relate to carbohydrates, lipids, proteins, nucleic acids, enzymes etc.…

A: Intermittent fasting (IF) is a term used to describe a variety of eating patterns in which no or few…

Q: 1. Starch can be completely digested and become monosaccharides in the presence of A. salivary…

A: Essentially all the carbohydrates in the food are absorbed in the form of monosaccharides. Only a…

Q: The answer is wrong, can you please check which is the correct answer from the multiple choice.…

A: The question provided was confusing as it didn't mention what has to be answered. Answer will be…

Q: Give the meanings for the following conditions: 11. hyponatremia - 12. polydipsia - 13. glycosuria -…

A: Medical biology is a branch of medicine which use laboratory methods (analysis, microscopy,…

Q: Draw the structure and give the name of a nucleotide made of adenine (A) and deoxyribose.

A: Nucleic acids are made up of nucleotide monomers that are polymerized to create long strands. The…

Q: a.What would happen if IKKbeta did not phosphorylate IkappaB? b.Why is it so hard to make cytokine…

A: IKKalpha, IKKbeta, and IKKgamma are the three sub units of IkappaB kinase. Out of these Ikk alpha…

Q: The damaged ozone layer is situated in- (A) lonosphere (B) Mesosphere (C) Stratosphere (D)…

A: Introduction - Between 15 and 30 kilometres above the earth's surface, the ozone layer protects…

Q: Turpentine oil is obtained from- (A) Coal (B) Petroleum (C) Cedarwood (D) Pinus

A: Introduction - Turpentine is a liquid produced by distilling resin from living trees, primarily…

Q: Why do cells need to be kept in the freezing devices first then transferred to liquid nitrogen…

A: Rapid freezing of cells can cause ice crystals large crystals can be formed in which cells are…

Q: tep 1 Staphylococcus aureus is a bacteria, that is now resistant to commonly used antibiotics, and…

A: Staphylococcus aureus causes a variety of infections that are difficult to treat, including…

Q: What is the difference between genotype and phenotype? 2. A black guinea pig is mated to a white…

A: Alleles are the alternative form of a gene that are located on the same locus of homologous…

Q: To determine: The causes of nitrogen deficiency in plants.

A: One of the major causes of poor yields in plant crops is nitrogen shortage. Nitrogen is a critical…

Q: The is the foundation of a medical term The comes at the end of a medical term The is attached to…

A:

Q: Explain the reason why modern biologists can more easily accept that a mammal can have some reptile-…

A: Mammalia is the class of mammals. They are warm-blooded creatures that control the terrestrial…

Q: 1. True or False: Positive predictive value of a screening test depends on its sensitivity and…

A: Introduction The proportion of a population who have a particular trait in a given time period is…

Q: Which is NOT a role of sebum in the innate immune system. Group of answer choices dehydrates…

A: Sebaceous glands are present on the skin. The glands are mostly present on the chin, forehead and…

Q: Some sperm mitochondria enter an egg during fertiliza- tion, but as sperm mature these mitochondria…

A: Fertilization in humans refers to the fusion of male and female gametes that facilitates the…

Q: Q4

A: The physiological lack which the sperm fulfills for an ovum is the lack of spindle set for…

Q: __________ are composed of a single linear (unbranching) chain of covalently bound amino acids.…

A: Amino acids are known as the building blocks of protein. These are organic compounds mainly composed…

Q: To determine: The causes of nitrogen deficiency in plants.

A: Plants require mineral elements for their nutrition. These are classified into -  Macronutrients…

Q: What is eusociality and list down some characteristics of a eusocial system?

A: There are levels of society defined in the text, the highest being the Eusociality.

Q: Since different species of penguins may occupy the same habitat, explain why they may continue to…

A: Introduction Species include the members who are similar in morphology, and physiology and can…

Q: The following statements are correct except* a. Assimilates are transported from areas of supply to…

A: Food, primarily sucrose ( assimilate) is transported by the vascular tissue of phloem from a source…

Q: Which one of the following is ordinarily not an air pollutant ? (A) CO2 (B) CO (C) SO2 (D)…

A: Pollution: Pollution is referred as undesirable change in the biological characteristics of water,…

Q: he arteries that pass through the heart muscle are necessary for delivering enough oxygenated blood…

A: When the pressure inside the arteries is less than the pressure outside the arteries (due to…