Describe the process of chemical digestion of our three major macronutrients, carbohydrates, proteins and fats, as one travels down the human digestive tract. Where does chemical digestion begin for each one of these? Where does chemical digestion continue for each one of these three, and where is this process completed? In your description, please include the enzymes involved
Q: Relative to carrying capacity, what from unbridled continued growth population? o foto may result of…
A: Population Growth refers to the increase or decrease in the size of a population over time,…
Q: Muller's rachet turns faster in......…... species with small genomes populations exposed to mutagens…
A: Introduction and answer= The theory of Muller' Ratchet predicts that small asexual populations are…
Q: In detail explain how photosystems I and II capture light using different photosystems
A: Photosystems, which are large complexes of proteins and pigments (light-absorbing molecules) that…
Q: You want to product human immunoglobulin G using a recombinant Escherichia coli system. Design the…
A: Recombinant tecnology The technology based on making hybrid DNA. In this technology, gene of…
Q: Write your own two-factor genetic linkage problem. Then, solve the question to create a linkage map…
A: When genes are found on different chromosomes or far apart on the same chromosome, they assort…
Q: What type of vertebrae are these? How do you know? (what are the distinguishing features) What type…
A: The human skeleton is the inside structure of the human body. It is made out of around 270 bones…
Q: The is the organelle that is formed when an endosome, containing hydrolytic enzymes necessary for…
A: Cell is the basic structural and functional units of organism. The cell is made up of various kinds…
Q: Fill-in the blank A person who is heterozygous for sickle-cell anemia a. has the disease b. C. does…
A: Sickle cell anaemia is an autosomal recessive disease meaning two defective or mutated alleles are…
Q: TRUE OR FALSE: Digestive secretions from the small intestine complete the digestion of…
A: We know that The system helps in the breakdown of large and complex food particles into smaller and…
Q: methyl group Question #2 Copy the structures of the following amino acids from page 40 in your text:…
A: Amino acids are very important as they act as building blocks for the synthesis of proteins. They…
Q: Give an overview of the applications of microbial biotechnology that could help curb the spread of…
A: Microbial Biotechnology involves using microbes (organisms that can't be seen with the naked eye)…
Q: How will the cell shift its metabolic processes in response to the level of pyruvate and in order to…
A: Cellular respiration is the process by which energy is captured from food in three main stages. They…
Q: Compare the mechanisms of LINE and SINE transposition
A: Non LTR retrotransposons dont contain long terminal repeats but they contain genes for reverse…
Q: Which stage of succession has the strongest interspecific First stage of succession competition?…
A: The ecological succession is the sequential changes in the species composition in a particular area…
Q: Given the following, the sequence of urine flow in the urinary tract is: i. Renal papilla ii. Major…
A: Urine The typically yellowish colour wates fluid filtered by the kidney and stored in urinary…
Q: Which BEST describes how survival of the fittest relates to natural selection? A) Organisms with…
A: Introduction Charles Darwin proposed the theory of evolution by natural selection, which states that…
Q: Explain why afterload is critical in cardiac function and maintaining long-term heart health
A: The systolic of the heart can be determined by three factors preload and afterload and contractility…
Q: The following contains a greater concentration of particles in comparison to another body of fluid:…
A: The solvent particles in a solution can not move randomly without any definite direction when…
Q: what does mature mRNA look like after processing? Include 5'cap, 5' UTR, +1 site, exons, 3' UTR,…
A: Introduction A ribosome reads messenger ribonucleic acid (mRNA), a single-stranded RNA molecule that…
Q: Explain how phylogenetic trees are interpreted and created. Explain what types of traits are used…
A: Explanation: A phylogenetic tree is a graphical depiction of the evolutionary connections between…
Q: Of the family of viruses we've studied, what type of virus is HIV (human immunodeficiency virus)?…
A: A virus is an infectious microbe made up of a nucleic acid segment (either DNA or RNA) surrounded by…
Q: How can transposons contribute to specific human diseases?.
A: Introduction Genetics is a branch of science that deals with the study of genes, heredity, and…
Q: X + e.learn.edgenuity.com/player/ ce- SC5181 A 3 On a remote island in the Pacific, a species of…
A: Introduction: A method of evolution known as genetic drift occurs when a population's allele…
Q: List five proteins of the myofilaments and describe their physical arrangement.
A: The myofilaments are the proteins that make up the contractile elements of muscle cells. There are…
Q: need a list of 10 miracles of respiration with its explanation
A: The main function of respiratory system is to take in oxygen and release carbon dioxide as a waste.…
Q: What is the difference between "diaphysis" and "epiphysis"? What is the difference between a…
A: Introduction Bones are the primary part of our skeletal system. They are responsible for providing…
Q: What are some enviromental factors that would have contributed to the large amount of bacteria on my…
A: Bacteria are prokaryotes and fall under kingdom-Monera. Bacteria are cosmopolitan and thus, are…
Q: Which one of the following is not a characteristic of invasive species? O Rapid reproductive rate O…
A: Introduction:- Any non-native species that significantly alters or disrupts the ecosystems it…
Q: “How this picture demonstrates people helping to maintain biodiversity?” Are people planting one…
A: The variety of life forms including microbes, plants, and others that can be found in a given…
Q: Based on the Movement of Water across a Selectively Permeable Membrane lab, what is a selectively…
A: Introduction :- An very thin layer of protein and fat makes up the cell membrane. It is referred to…
Q: Compare/contrast clathrin, COPI and COPII proteins. "I ... Cul JCC
A: COP 1, COP II and clathrin helps in transport mechanism. COPI, COP II and clathrin are proteins.
Q: Q4. You conducted an experiment similar to Morgan's fruit fly but you used honey bee instead. You…
A: Linkage is a phenomenon in which genes are exhibited on the same chromosome instead of another .…
Q: The AG of the reaction C6H12O6 + 60₂ --> 6CO₂ + 6H₂O is -686 kcal/mol glucose oxidized. The AG of…
A: In order to understand the reaction, a few basic definitions are provided below - δG refers to Gibbs…
Q: A M N D K H
A: A - eft lobe B - Right lobe C - Caudate lobe D - Quadrate lobe E - Falciform ligament F - Round…
Q: Which of the following statements about the post-translation modification of proteins by…
A: In eukaryotes, post-translation modification of proteins takes place. After a protein is formed ( by…
Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'
A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…
Q: List five proteins of the myofilaments and describe their physical arrangement.!?
A: Introduction: The building blocks of tissue are proteins. They are the most significant part of…
Q: Which of the following statements about the post-translation modification of proteins by…
A:
Q: (A) Which of the above offspring are recombinant? (B) What is the map distance between the genes?
A: ANSWER1. Recombinants: These are those offspring that have traits different from their parents.…
Q: The end products of glycolysis are O A. pyruvate. SO B. pyruvate, ATP, and NAD+. OC. acetyl CoA,…
A: Cellular respiration is a process that involves The breakdown of complex organic molecules with the…
Q: What are the neuronal and muscle properties that support the size principle of recruitment?
A: The size principle states that depending on the intensity, the smallest to largest motor units will…
Q: List examples that illustrate how the structure of a body part makes possible its function?
A: The principle that structure defines function is fundamental to biology. In other phrases, how…
Q: Enumerate the Good Microbiological Practices encountered in the activity.
A: Microbiological practices are those precautions which we have follow while working in the…
Q: Question: Identify one The two distinguishing features of the group known as catarrhines are…
A: Lemurs from Madagascar, lorises from Africa's Continent, and galagos from tropical Asia make up the…
Q: What is the name of the first cervical vertebra? Why is it called that? What is the name of the…
A: The long pillar like structure composed of bones called vertebrae, present as the longitudinal axis…
Q: A population consists of 300 individuals with the following genotypes: AA – 100…
A: Since p = 1 - q and q is known, it is possible to calculate p as well. Knowing p and q, it is a…
Q: Label the features of the tibia: (this is the front view) lateral condyle, intercondylar tubercles,…
A: The tibia and fibula are the bones of the leg and provides the strength to the leg for the movement…
Q: Why most you use deionized water rather than tap water in this experiment? A- Tap water has many…
A: Introduction : Distilled water is known as deionized water. It is purified water from which all the…
Q: What is the name of the first cervical vertebra? Why is it called that? What is the name of the…
A: Atlas is the name of our first cervical vertebra. It begins from the base of the skull. It is in a…
Q: is involved in anterograde transport of proteins from the ER to Golgi. Ocaveolin clathrin COP II…
A: The vesicle transportation across cell is mediated by the microtubules present in the cell. The…
Describe the process of chemical digestion of our three major macronutrients, carbohydrates, proteins and fats, as one travels down the human digestive tract. Where does chemical digestion begin for each one of these? Where does chemical digestion continue for each one of these three, and where is this process completed? In your description, please include the enzymes involved
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 3 images
- There are several processes that take place from the moment food enters our mouth until it is completely digested and used for energy. Using approximately 400-500 words, describe in detail and in order of process the mechanical (stomach and intestine)and chemical (gastric acid and enzymes) digestion of eating a grilled chicken sandwich with mayonnaise, lettuce, and tomatoes. Note what role the pancreas, gallbladder, and liver play in digestion of the ingredients? From what ingredients is your body deriving its energy and how many basic calories from the macronutrients ingested? Include at least two scholarly references (using APA formatting and style) to guide your answers (note that you can use your textbook as one of your references).create a flow chart or diagram to illustrate the digestion and absorption of carbohydrates. The starting carbohydrate molecules are starch, sucrose, lactose, glycogen, and cellulose. What will happen to these carbohydrates once we ingest them? Include the following from your flow chart or diagram: 1) the location or site where the digestion or absorption occurs 2) the enzymes 3) the products generated at each site or locationcreate a flow chart or diagram to illustrate the digestion and absorption of proteins. What will happen to the meat once we ingest them? Include the following from your flow chart or diagram: 1) the location or site where the digestion or absorption occurs 2) the enzymes 3) the products generated at each site or location
- Carbohydrate comes in the form of Sugar, Starch, Glycogen, and Fiber. What are the difference(s) between simple and complex carbohydrate? Give an example of each types of simple and complex carbohydrate. What are the main functions of carbohydrate in the body? Briefly list the steps of carbohydrate digestion from the mouth to the large intestine.Which of the following best describe protein digestion? . Protein digestion is a hydrolytic process regulated by pH changes in the gastro-intestinal track, and hormonal and enzyme releases at various stages of digestion. .. Protein digestion occurs during the gastric phase of digestion starting in the stomach. Protein digestion cleaves peptide bonds releasing peptides, and amino acids Protein digestion is a hydrolytic process involving proteases/ proteinases Protein digestion occurs at the active site of proteases and is effected by the catalytic triads.Barb suffers from Crohn’s disease, a regional inflammation of the intestine that is thought to have some genetic basis, although the actual cause remains unknown. When the disease flares up, she experiences abdominal pain,weight loss, and anemia. Which part(s) of the intestine is (are) probably involved, and what might be the causes of her signs and symptoms?
- During the _____ phase of digestion, blood glucose levels drop and our body must depend on stored energy. The sympathetic nervous system directs the pancreas to release glucagon, which causes glycogen to be transformed back into glucose. Glucagon also causes stored fat and glycogen to be released into the bloodstream. A) fasting B) exhaustion C) resistenceWith the two menus provided, answer the question below: Menu 1: Roasted chicken with mashed potatoes (mostly proteins and carbohydrates) Menu 2: Pasta with alfredo saude and cheese (mostly carbohydrates, dairy products and lipids) Question: Describe the steps in the chemical digestion of the main constituents of your meal (name the enzyme (s) and other secretions involved, and what cells secrete them), all of that from the beginning to the end of digestion.Arrange the following statements regarding the processes of protein metabolism starting from Step 1 to Step 10. Conversion of pepsinogen to pepsin by HCI • Active transport takes place • Conversion to individual amino acids Glutamate becomes alpha-ketoglutarate Mechanical digestion to go to the small intestines • Shuffling of amino group to generate glutamate • Conversion of proteins to simpler polypeptides Removal of basic and acidic functional groups Enters the Kreb Cycle • Acidic denaturation and hydrolysis of proteins
- Describe what happens to the food types specified below as they pass through the following zones of the Digestive system Mouth, Stomach, Small intestines, large Intestines. Specify the food example (Carbo-rich food)rice, (protein rich) chicken adobo, (fat rich food) crispy pata, Identify the enzyme that catalyzed the digestion process and the source enclosed in parenthesis. 1 Carbohydrate-rich food 2. Protein-rich food 3. Fat/lipid-rich foodIn order for the food to be processed and absorbed in an optimal way, there are several feedback mechanisms. One of the most important starts when the food reaches the small intestine, this is sometimes also called the intestinal phase. Describe what happens if the food that reaches the duodenum contains a lot of fat and a lot of protein. The answer must include: Which different mechanisms are affected by the respective stimuli (fat and protein) and how (increases or decreases the activity). What cell type senses stimuli and how these cells react. Which different signaling pathways (including the signaling substances involved) control the different mechanisms that are affected by the respective stimuli. Feel free to draw.Which of the following is NOT an enzyme secreted into the small intestine as an aid to chemical digestion: A) Bile B) Lipase D) Amylase