Crick and Watson, whose work greatly contributed to the discovery of the double helical structure of DNA, got Nobel Prize. Lütfen birini seçin: О а. False о ъ. True
Q: Below is a sequence of DNA.…
A: Introduction :- Adenine (A), thymine (T), cytosine (C), and guanine (G) are four nucleic acid bases…
Q: Identify the template and non-template strand on the DNA. B TACGGATACG UACGGAUA ATGCCTATGC
A:
Q: If one strand of DNA has a sequence of TCAG, then the sequence of bases on the complementary strand…
A: DNA is double stranded where the two strands are antiparallel and follows complementary base…
Q: If you are given the DNA sequence: T-A-C-G-G-T-C-A, determine the complimentary DNA strand.
A: DNA is the molecule which stores the genetic information in an organism that makes the nucleotide,…
Q: The English language, based on 26 letters,can create an infinite variety of words, but how can an…
A: As English language 26 letter arrange itself in a meaningful word similarly in Dna arrange of each…
Q: The DNA sequence you use will be the following: T - A - G - C - C - A. You will need to make the…
A: chargaff's rule states that in DNA sequence in complementary strands the Adenine will form a bond…
Q: Give the DNA compliment to the following DNA strand. GTA SMH UUU GUA CAT
A: In DNA replication, the rule of complementarity is as follows- 1. Adenine (A) and Thymine (T) are…
Q: The letter R isconventionally used to represent anypurine base (A or G) and Y to represent…
A: Purines and pyrimidines are the two families of nitrogeneous base that are used to make nucleic…
Q: why the human dna is considered as a fibonacci sequence?
A: A Fibonacci Sequence is where each number is the sum of two preceding numbers, like…
Q: An inappropriate base change that has no discernible effect is called a _____________ mutation.
A: The mutation is the process, which helps to change the bases in the DNA segment and exert different…
Q: The following are DNA fragments containing a small gene. The top strand is the coding strand.…
A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…
Q: The Universal Genetic Code Table can be used to determine the gene product of a given nucleotide…
A: mRNA consist of mononucleotide sequence that specifies amino acids sequence in peptide chain. One…
Q: In addition to the standard base-paired helical structures, DNA can form X-shaped hairpin structures…
A: Cruciform DNA is a form of non-B DNA that requires at least a 6 nucleotide sequence of inverted…
Q: Choose the correct protein sequence that would result from the following DNA template sequence using…
A: Central dogma is the central cellular process that helps in the conversion of the DNA to m RNA by…
Q: Identify the type of mutation shown Original Sequence: GGC TAC ATG GAA Mutated Sequence: GGC TAA TGG…
A: Original Sequence: GGC TAC ATG GAAMutated Sequence: GGC TAA TGG AA
Q: When part of a nucleotide in a nucleic acid chain, which of the following may base pair with uridine…
A: Uridine is a major form of pyrimidine nucleotide, from which cytosine and uracil are derived. It is…
Q: Given the following strand of DNA: 5' CATAGCCTTA 3' Which of the following sequences is the…
A: DNA and RNA are nucleic acids present in organisms. DNA is the deoxyribose nucleic acid whereas RNA…
Q: Please draw the structure of DNA and label the parts. Thank you very much for your help
A: Deoxyribonucleic acid (DNA): DNA is a type of molecule known as nucleic acid. It is the blueprint…
Q: When nitrogenous bases in single-stranded polynucleotides are incorporated into doublestranded…
A: DNA and RNA both absorb maximum light of 260 nm wavelength. 260 nm light comes in the ultraviolet…
Q: Draw the following strands of DNA 5’ C-A-T 3’ as well as the complementary base pairing strand…
A: Two strands of DNA twist around one another to form a double helix DNA and both are in anti-parallel…
Q: at is the methyl group-containing nucleobase composition of a double- nded eukaryotic DNA with…
A: DNA is made up of nucleotides.Each nucleotide is made up of nitrogenous base, phosphoric acid and a…
Q: What is the nucleotide sequence of the complementary strand of the DNA molecule:…
A: Nucleic acids are large macromolecules that store hereditary information for cellular growth and…
Q: A DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA…
A: Gene probes are small, single-stranded DNA or RNA that hybridize with the target DNA sequences in a…
Q: By convention, nucleotide sequences are always written from the _____.
A:
Q: How many nucleotides would be necessary to code for 10 amino acids? Please help, I am lost!
A: Introduction :- DNA and RNA are made up of nucleotides, which are the basic building blocks of both.…
Q: Which of the following equations is a prediction based on Chargaff’s rules for the content of DNA?…
A: Chargaff's rule says that DNA should have 1:1 ratio of pyrimidines and purine bases. According to…
Q: Please choose the correct answer. Given the sense strand of DNA, A T G T A A C C G C G C A A G G G C…
A: Transcription is the process in which RNA is made from DNA. Translation is the process of making…
Q: If this sequence of bases was on one side of a DNA moléčulé, whát wõuld be on the opposite side?…
A: The answer is TTTAGCC. The last option.
Q: How do you translate this into amino acid sequence
A: The process of synthesis of protein with the help of messenger RNA is called translation. In the…
Q: Write the complementary sequence for the following DNA sequence, in order from 3' to 5':…
A: Deoxyribonucleic acid (DNA) is the hereditary unit of life, which carries the genetic information in…
Q: The "D" in DNA stands for which of the following?
A: DNA : Chemical name for molecule which carries genetic instructions in the living organisms.
Q: Are the following base sequences “sticky” (complementary) or not? All sequences are written 5′ to…
A: The purines (adenine and guanine) and the pyrimidine (cytosine, thymine) are the two types of…
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the…
A: Deoxyribonucleic acid (DNA) is a molecule with two chains of polynucleotides that wrap around one…
Q: ns: In each box, type the hrst letter of the base that correctly matches the given DNA sequences C…
A: Answer. A nucleotide is the monomeric unit of nucleic acids. Nucleic acids are therefore also called…
Q: Identify the dinucleotide CA repeat region and the score in the following sequence:…
A: Nucleotide is defined as the basic block of DNA and RNA that also known as building block of it.
Q: For a closed-circular DNA molecule of 6,825 base pairs in the fully relaxed form, the linking number…
A: In simple words, the linking number represents the number of times a curve winds around another. The…
Q: As pointed out in the text, you and a complete stranger are 99.9% identical in DNA sequence. But you…
A: Introduction: 99.9% genome similarity is present in humans and the remaining 0.1% is different. This…
Q: Which lane shows the DNA fragment completely digested with Pst n
A: Restriction endonuclease are the enzymes which cleave the DNA at specific sites Various sites are…
Q: Please draw or send me a picture of the structure of DNA and label the parts. Thank you very much.
A: Deoxyribonucleic acid: DNA is a genetic material that is present within the nucleus. It was…
Q: If I have a DNA sequence of 5’ ATTGGCCGCA 3’, what is the complementary strand?
A: DNA molecule has got two antiparallel helix or strands winded together. If we know the sequence of…
Q: A DNA sample contains 21% adenine. What is the complete percentage base composition?
A: Given Values: dsDNA has A = 21%
Q: Which of the following features is associated with the Watson and Crick model of the DNA?
A: 1. Watson and crick described that DNA strands right which twisted around each other forming right…
Q: Gly Leu (F) (L) Glu Asp (D) Ser (S) Tyr Ala (A) GUC Cys (C) G U Val (M) U GNP (W). Arg (R) G A C Leu…
A: Any change in the genetic material, which is not caused by recombination, that leads to altered…
Q: Write out the DNA sequence using the following instructions: This is a double stranded DNA hydrogen…
A: The nucleotides polymers are responsible for determining and regulating the genetic characteristic…
Q: 3. Examine the following DNA sequence and determine wh type of mutation, if any, produced the…
A: A heritable genetic change in the genetic material of an organism that gives rise to alternate…
Q: If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the…
A: Question -If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the…
Q: Draw a G}C base pair. Draw an A}T base pair.
A: Introduction Nitrogenous bases are nitrogen-containing biological substances that create…
Q: Using Chargaff’s rule of base pairing determine the amount of guanine in 120 bp long fragment of…
A: According to Chargaff's rules, DNA from every species of any organism should have a 1:1…
Q: The following are DNA fragments containing a small gene. The top strand is the coding strand.…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Step by step
Solved in 2 steps
- A DNA strand was sequenced using the Sanger method (https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction tube contained the DNA strand, fluorescently labelled dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green, ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA polymerase, or its Klenow fragment. Synthesis of DNA is allowed to proceed, and the results are shown on the right: 15 14 13 12 11 10 (a) What is the sequence of the copy and the template strands? (b) If the template strand were in the 5'-3' direction, what will be the sequence of the DNA copy? Nucleotide LengthState the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helixChoose all of the statements that correctly describe the base pairs drawn below. A C H H-N -H-N N-H- -N B H D موعة Rita N -H---- 2 NHN O- -H-N H -H- N- -H-N The non-Watson-Crick base pair shown in A is much less stable than the base pairs shown in B and C, because the smaller size of the two pyrimidine bases induces a distortion in the structure of the double helix that decreases the stability of the helix when compared to helices with the normal Watson-Crick base pairs. The base pair shown in B is found in BOTH DNA and RNA The base pair shown in C is found ONLY in RNA and NOT DNA The base pair seen in B is more stable than the Watson-Crick base pair shown in C partly because of a larger number of hydrogen bonds and partly because of more favourable pi-stacking interactions with adjacent base pairs.
- There are numerous methods for sequencing DNA, including classical Sanger sequencing, automated Sanger sequencing, and next-generation sequencing technologies, including Illumina technology. Match the modified cytidine nucleotide triphosphates (NTPs) with DNA sequencing methods that utilize them. Classical Sanger sequencing HO-P=O O HO-P=O O HO-P=O O Automated Sanger sequencing -NH₂ CH3 H₂CN ° ? ?N HOOOO OH OH OH NH CH₂ Next-generation DNA sequencing (Illumina) CH₂ NH₂ Answer BankBoth protein and DNA are run together in an isoelectric focusing (IEF) electrophoresis using the immobilised pH gradient (IPG) strip with pH range of 4-7. After the electrophoresis and staining, only ONE band is observed on the middle of the IPG strip. The band is a protein band. Briefly explain why only the protein band and NOT the DNA band appear on the IPG strip.if you have the following sequence of DNA 5' ATTGCGGAGCCTCGAT 3' do the following:
- HN N C N H₂N HN پرسپولیو D B CH₂ -N N NH₂ E When part of a nucleotide in a nucleic acid chain, which of the following may base pair with thymine nucleotides? Choose all correct answers and assume normal Watson-Crick base pairing.The anti-viral drug Acyclovir is a nucleotide analog that is lacking the 3’ OH group which is required to form a 3’→5’ phosphodiester bond. This drug is ineffective against DNA polymerases with proofreading abilities, which is why human DNA polymerases are not targeted. Acyclovir can be used to treatsevere cases of Epstein-Barr viral (EBV) infection, but has little to no effect under non-severe infections. Based on this information, EBV will use ________ DNA polymerase during severe infections and __________ DNA polymerase during non-severe infections. Human; Human EBV; Human EBV; EBV Human; EBVWhether done manually or automated, DNA sequencing gels are always made of polyacrylamide rather than agarose. Why can't agarose be used for a sequencing gel, as it is for other DNA gel electrophoresis?
- The image below was the basis of Watson and Crick to be able to elucidate the DNA structure. Explain/Discuss the meaning of this image as seen by Watson and Crick and how was it able to support the present-day structure of the Watson and Crick DNA?a) Explain the effect of the guanine:cytosine ratio on melting temperature of DNA. b) The Hershey-Chase experiment proved that DNA is the genetic material and not protein. Explain in detatil how this experiment was conducted.Design a pair of primers to amplify the entire length of the following 45 base pair sequence.Make each primer 14 bases long. Write the sequences of the primers in 5' to 3' order.(Hint: It will help for you to write out BOTH strands of the DNA sequence listed below.5'-GATGCCCGTTGGATAAATTGGGCGTCTAGAATCGGTCACACTTAG-3'