Consider the following simple regulatory pathways. Assume the full pathway is shown. A- E- B- F- C- G- D- 1 A H- 2 B 3 C- TT 4 D You identify several null mutations (a complete deletion of the gene). For each mutant (indicated with a sign), determine whether the final product (I, J, K or L) is inducible, uninducible, or constitutive. [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] E [Choose ] F G H I J K L
Q: Order: streptomycin 500 mg IM daily for 8 days. If you have vials of this antibiotic that are…
A: One must compute the dosage based on the vial's concentration and the recommended dose in order to…
Q: Fill in the gaps in the paragraphs below: Blood pressure can be regulated by the nervous system, in…
A: The two parts of the autonomic nervous system are- sympathetic and parasympathetic. The sympathetic…
Q: 3. Describe the relationship between the concentration of sucrose and the rate of osmo- sis? Use…
A: The ease with which a molecule can flow through a cell membrane is referred to as "permeability".…
Q: Can you be more specific please?
A: By regulating the synthesis of proteins required for numerous cellular activities, gene…
Q: 5. The major organizing center of the gastrulating embryo is the A. Inner cell mass B. Primitive…
A: Gastrulation is a highly specialised process that happens during embryonic development's third week.…
Q: The oldest known of the sites listed below that has modern human remains is____. a. Kabul b. Klasies…
A: The question relates to identifying the oldest known site with modern human remains among the given…
Q: When D-gulose forms a ring structure, a) b) a ketone and a hydroxyl group react to form a hemiketal.…
A: Aldohexose sugar D-glucose can go through a process called cyclization to create a ring structure…
Q: which 2 of the following are characteristics of the sodium potassium pump. sel - structure -…
A: Sodium-potassium pump is a transmembrane protein that helps in the transport of Sodium and potassium…
Q: Cockroaches are nocturnal insects and are active at night and inactive during the day. You place…
A: Cockroach activity patterns were examined, and an experiment was run to find out what circumstances…
Q: 8. Professor X at the University of Hong Kong recently identified a new gene "LivX" which is only…
A: The gene is the sequence of nucleotides that code for a specific protein in a cell. The expression…
Q: The phosphorylation and oxidative decarboxylation of oxaloacetate by inorganic phosphate (Pi) to…
A: In biochemical processes, the energetics of reactions play a crucial role in determining their…
Q: It’s late summer and a new influenza virus strain has appeared in chickens across the country. It’s…
A: I would analyze the genetic sequence of the new strain and compare it to the key mutations…
Q: Give typing answer with explanation and conclusion there are many patients who have atrial…
A: Atrial fibrillation occurs in different patterns. This may cause stroke, heart failure, and other…
Q: 18. How is a nerve impulse transmitted across a synapse from a presynaptic to a postsynaptic cell?…
A: The correct answer to the question is: c. via a neurotransmitter
Q: create a flow chart of the pathway of a sperm from the males testes to the oviduct
A: Reproductive system is one of 11 body system which is involved in formation of gametes, sex…
Q: 아 70 60 50 4000 3297 3296 3072 2997 2996 3000 Wavenumber [cm-11 2000 1635 1630 1536 1447 1448 1534…
A: FTIR is used in understanding and identifying organic, inorganic and polymeric compounds in a given…
Q: 5. Which of the following is an example of a closed population? a. a group of frogs living in a…
A: A closed population is a group of organisms that does not experience any immigration or emigration.…
Q: What is the size of the DNA sample based on the gel profile below? Make sure to indicate the units.…
A: Electrophoresis is the technique to separate biomolecules depending on their…
Q: Which is the correct answer please? What would a biologist say is the role of nutrients in an…
A: Living organisms made up of different biomolecules such as carbohydrates, lipids, proteins, vitamins…
Q: 2. Explain why dispersal behaviour shown amongst majority of species improves reproductive success.
A: Dispersal is a process that mainly involves the movement of specific individual or multiple…
Q: Match each item with the correct statement below concerning the electron transport chain and…
A: Aerobic respiration is a type of respiration that involves the use of oxygen for complete oxidation…
Q: The 6 genetic inheritance patterns that do not follow Mendel’s Laws.
A: While Gregor Mendel's laws of inheritance, known as Mendelian inheritance, explain many patterns of…
Q: Task 4 of 6 (AC 2.1) No more than 200 words for the task A. Label the conductive tissues in the…
A: A fist-sized organ, the heart circulates blood around your body. It serves as the circulatory…
Q: W = white (W dominant over w) (WW lethal) (W overrides all other pigments/patterns/colors). G =…
A: In the above question, Gregor Mendel's laws of inheritance comes into play. These include :-1.…
Q: Identify the feature of the heart labeled "7" in the picture. A Identify the chamber of the heart…
A: The heart is a muscular organ located in the chest that serves as the central pump of the…
Q: Mrs. C is a 50-year-old woman who presents with joint pain. She reports the pain has been present…
A: Rheumatoid arthritis (RA) is a chronic autoimmune condition marked by synovial joint inflammation…
Q: 2. What is the chemical reaction for this process? Fill in the blanks below: C6H₁2O6 + yeast + H₂O…
A: Fermentation is a procedure in which microorganisms use chemical processes to change carbohydrates…
Q: Differentiate between hemodialysis and peritoneal dialysis.
A: Dialysis:-Dialysis us a special type of process that removes waste products and also excess fluoid…
Q: 2. Twist transcription factors (TF) play key roles in embryonic development and are largely…
A: Twist transcription factors are attaches to specific regions of DNA and they controls the activity…
Q: Name the three major assumptions made by the "Cell theory". (i) The lipid membrane is composed of…
A: The "Cell theory" is a fundamental principle in biology that describes the basic characteristics of…
Q: Why do you think science is an important field of study? How does science impact our day to day…
A: Science has a role in ensuring better times for future generations through researching the effects…
Q: 2. GTPYS is a non-hydrolysable analogue of GTP. Predict the consequences of using GTPYS in the cell…
A: GTPγS (guanosine 5'-[γ-thio]triphosphate), are commonly used in experimental settings to study G…
Q: 10. Two individual plants (A and B) have the following sets of replicated chromosomes (see figure).…
A: Genetic variations are important for the evolution and diversity of species. These variations can…
Q: what are the alignment to national imperatives and data management and utilisation of conservation…
A: Fish of the order Siluriformes, which includes catfish, are a diversified group. Their name comes…
Q: 6. For the pedigree below, does it show an Autosomal Dominant, Autosomal Recessive or X-linked…
A: A pedigree is the diagrammatic representation of inheritance of any trait or character in the…
Q: can you tell me what group of viruses (groups 1-7) each image represents and explain how you know?
A: The Baltimore classification system is a hierarchical classification scheme for viruses, developed…
Q: COMPLETE THE CHART USING (+) or (-) Organism 5% Sheep Blood Agar Incubated 37°C for 48 Hrs Alpha…
A: When cultivated on a blood agar plate, red blood cells undergo hemolysis or breakdown or…
Q: In the table below, discuss the structure and functions of arteries, veins and capillaries:…
A: The circulatory system consists of arteries, veins, and capillaries, each with its unique structures…
Q: 1. Can you label the start and stop transfer signals based on the rules we just went over? 2. Draw…
A: These proteins are synthesized in the cytosol and based on the signals present on their surface,…
Q: Two views of a specimen of a urinary bladder are presented. First you must recognize / identify the…
A: The urinary bladder is a hollow, muscular organ located in the pelvic region of the body. Its…
Q: 1. How are protists classified a. By the way they move and obtain nutrients b. Number of organisms…
A: As per our company guidelines we are supposed to answer only first 3 questions. Kindly repost other…
Q: 3. Occurs when a group of cells gain a bias toward a certain fate (the normal fate) and if isolated…
A: Determination is the process by which a group of cells become committed to a specific developmental…
Q: Which of the following ion transport functions must be carried out by a pump? a. transport of Na+…
A: The flow or movement of ions across membranes is dependent on establishment of ion gradient. Every…
Q: One day while walking across campus, you see a female butterfly laying fertilized eggs, as shown in…
A: In this scenario, we are presented with a female butterfly laying fertilized eggs on a leaf. Each…
Q: 1st Bag: shredded wheat original cereal, Warm water, and yeast (no sugar) 2nd Bag: Cinamon Toast…
A: Fermentation is a fundamental biological process that has been harnessed by humans for centuries to…
Q: Which of the following were newly discovered at the depths of the Monterey Bay sea floor? A.…
A: The statement poses a question about newly discovered species at the depths of the Monterey Bay sea…
Q: Is the removal of damaged proteins more important than the proper funciton of new proteins? Yes or…
A: Q.Ans:- Explanation:- Damaged Protein:- Damaged proteins can be formed in multiple ways such as…
Q: Describe the process of inserting DNA into a vector
A: The process of inserting a desired fragment of DNA or a gene of interest into a self-replicating…
Q: explain the offspring phenotype when these two are combined PP x pp and Pp x pp and explain your…
A: In a diploid organism, two alleles for a particular gene are expressed and interact to generate…
Q: 7 A-C
A: The T4 bacteriophage is a distinct virus affecting Escherichia coli (E. coli) bacteria. It belongs…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Consider the following simple regulatory pathways. Assume the full pathway is shown. A- E- B- F- C- G- D- 1 A H- 2 B || L You identify several null mutations (a complete deletion of the gene). For each mutant (indicated with a - sign), determine whether the final product (I, J, K or L) is inducible, uninducible, or constitutive. 3 C 4 D inducible inducible constitutive uninducible constitutive inducible inducible E uninducible F G H > I > J KConsider the following simple regulatory pathways. Assume the full pathway is shown. A- E- B- F- C- G- D- 1 H- A You identify several null mutations (a complete deletion of the gene). For each mutant (ind with a - sign), determine whether the final product (I, J, K or L) is inducible, uninducible, or constitutive. 2 B 3 C 4 D inducible inducible constitutive uninducible constitutive inducible inducible E uninducible F G H > > >The lac genotypes are as shown below: P+OcZ-Y+A+// P¯O+Z+Y+A+ (i) The lac operon consists of three structural genes, lacZ, lacY and lacA. Which structural genes are involved in lactose metabolism? Explain. (ii) Draw and explain how lactose repress the gene expression in lac IS/I- heterozygote. (iii) What is the function of the promoter in the bacterial operon?
- Consider the following 4 regulatory pathways (recall arrows are activators and blunt ends are inhibitors). 01 2 3 1 A- 4 2 B- 3 C- 4 D E F G H T1 I Which of the following pathways would result in the final gene (I, J, K or L) being activated by the presence of the first gene (A, B, C, or D)? Select all that apply. J K LIf the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individualO The lac operon in E.coli encodes enzymes necessary for the breakdown of lactose. For each enzyme (lac Z and lac Y), indicate with a + or-whether or not it is made when there is no lactose or when there is lactose. B-galactosidase (lac Z) No Lactose Permease (lac Y) Lactose Lactose No Lactose Genotype PP0 Z Y/I P*O*Z•Y* I'POCZ Y*/I P* O©Z*Y° P O Z'Y/I P'OʻZ'Y* PP O ZY*/IP*O*Z*Y* IP OCZ Y /I P*O*Z•Y* IPO ZY*/I* P*O©Z*Y• I'PO*Z Y*/IP'O*Z*Y°
- A number of mutations affect the expression of the lac operon in E. coli. The genotypes of several E. coli strains are shown below. ("+" indicates a wild-type gene with normal function and "-" indicates a loss-of-function allele.) Please predict which of the following strains would have the lowest beta-galactosidase enzyme activity, when grown in the lactose medium. Orpt o* z* r* Orpt ot z* Y OrptoztY Orrotzr OrPotz*YCTP synthetase catalyzes the glutamine-dependent conversion of UTP to CTP. The enzyme is allosterically inhibited by the product, CTP. Mamma- lian cells defective in this allosteric inhibition are found to have a complex phenotype: They require thymidine in the growth medium, they have unbal- anced nucleotide pools, and they have an elevated spontaneous mutation rate. Explain the likely basis for these observations.Consider the mechanism of the enzyme RNase: What would happen to the Km (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a lysine? Explain. What would happen to the Kcat (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a valine? Explain.
- Point mutations in multiple tumor suppressor proteins have been linked to cancer. For example changes in the gene for adenomatous-polyposis-coli protein (APC gene) may result in colorectal cancer. Consider the following DNA sense strand. 3'-TAC CGG TTG TGA AGC TGA ATC-5' (i) (ii) (iii) (iv) Derive the mRNA molecule from the given DNA strand sequence above, paying attention to the polarity of the molecule. Write down the polypeptide chain sequence arising from the mRNA molecule of the question above, using the table of the genetic code (Table Q1 overleaf) and indicate the C- and the N-terminus of the peptide chain. Point mutations of a cytosine (C) often lead to the dysfunction of the APC protein. Write down all possible polypeptide chains that can result from all possible DNA mutations of cytosines, disregarding a mutation in the MET/START and STOP codons. I Specify which of the point mutations identified in (d) are redundant?Each type of molecule listed below is recognized by a specific class of nuclear import receptor (importin) or nuclear export receptor (exportin). For each type of molecule, state whether you think it is recognized by an importin or exportin and explain why (in terms of where that molecule is synthesized, what that molecule does, and where it does it). (a) RNA polyermase II: (b) ribosomal protein: (iii) †RNA:Shown is part of the coding strand of the HBB gene involved in sickle cell disease. What will be the effect on the resulting peptide of a deletion of the two nucleotides shown in bold/underline? 5' CTG ACT CCT GAG GAC 3' a) A change from glutamic acid to valine will occur b) The deletion will not result in a change to the polypeptide c) A nonsense mutation will occur d) The polypeptide will be missing one amino acid, but the reading frame will be preserved