Concentration of Oxygen in Water Temperature (°C) Oxygen Concentration in Freshwater (ppm) Oxygen Concentration in Seawater (ppm) 1 14.0 11.0 10 11.5 9.0 15 10.0 8.0 20 9.0 7.5 25 8.0 7.0 30 7.5 6.0
Q: AC CAG CCC AAG ATT ____________ Transcription: Translation:
A: The flow of genetic information in a biological system is explained by central dogma and it involves…
Q: Explain the process of seed development in a typical angiosperm plant. 2. Describe the two -stage…
A: Angiosperms are flower-bearing plants and are the most diverse group of terrestrial plants. The…
Q: A. The double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical…
A:
Q: Consider the similarities and differences in the reproductive cycles (haplontic, diplontic, and…
A: All these life cycles are based on the haploid and diploid phases. This is called alternation of…
Q: How are antibodies to Salmonella H antigen produced? A) antibodies to H antigen are isolated from…
A: The antibodies are produced by the B cells of the vertebrate body. The B cells are present in the…
Q: Illustrate an egg. Show and describe the following poles. (a) Animal pole, (b) Vegetal pole
A: The mature ovum that is ovulated and unfertilized egg is typically more less spherical oval or…
Q: To describe: The ecological niche of humans.
A: The intended function that an organism performs within an environment is its niche. The biotic…
Q: Choose the word that best describes the picture provided. * O potential resource reserve resource O…
A: Potential resources are those which exist in a region and and which can be used in the future.…
Q: Identify the different components of the mammalian (human) blood, describe each and give their…
A: The circulatory system is a system that contains the heart, blood vessels, and blood, and blood is…
Q: Match the virus in column A with its description in column B. Answers may be used more than once.
A:
Q: Distinguish between monohybrid, dihybrid and test crosses. Maximum number of characters (including…
A: Difference between monohybrid and Dihybrid test cross are given below -
Q: How can one cell give rise to different types of cells? Support your explanation with embryologic…
A: Introduction A cell is a cytoplasmic mass that is outwardly bound by a cell membrane. Cells are the…
Q: Q4) The relative volume of red blood cells can be known by measuring the hematocrit (the ratio…
A: Blood It is a type of connective tissue that connects whole body. It carry oxygen to every cell of…
Q: Use the following diagram to explain how Pasteur’s swan-necked flasks prevent contamination of…
A: Introduction The name "Swan Neck Flask" comes from Louis Pasteur's use of a particular flask with a…
Q: What is the hazard of the splattering tendency in flame sterilizing an inoculating loop? Can…
A: Aseptic preparation of culture media :-
Q: In terms of aerobic cellular respiration, explain how the irreversible steps of glycolysis and…
A: These are the liver cells that have the maximum capacity to perform glycolysis. Because these cells…
Q: Genetic variation is evident. The variation in your community is simple evidence of understanding…
A: Genetic Variation Individual creatures of a species can have different gene sequences, which is…
Q: The red and white pulp of the spleen is so named A to reflect the staining pattern of tissues…
A: Introduction The spleen is a fist-sized organ located close to stomach and behind the left ribs in…
Q: escribe the behavior and neural mechanisms involved luring cricket communication used for…
A: Crickets are nocturnal, so they chirp at night. Male chirp to attract the female for mating. “…
Q: 3. Estimate the flow resistance in a small arteriole (lumen diameter 25 microns; length 0.1 cm) for…
A: Introduction The proportion of red blood cells in your blood is measured by a hematocrit test. Your…
Q: Can gelatin hydrolysis be correlated with the pathogenicity of a bacterium? Explain your answer
A: Disclaimer: “Since you have asked multiple questions, we will solve the first question for you. If…
Q: VARIATION IN POPULATION DENSITY OF BEETLES 40 35 30- Species A Species B Species C 25 20- 15 10- 5…
A: Population density: Population density is actually the concentration or total number of a particular…
Q: In a chemical reaction catalyzed by an enzyme, the enzyme: O becomes the substrate is destroyed does…
A: Enzymes Enzymes are biological catalysts that speed up the rate of the biochemical reaction. Most…
Q: Question 19 Based on the hydropathic index plot below, where in the 3D structure of the protein…
A: To study hydropathy index, we should first note down the following points: Integral proteins are…
Q: What are the legal risk of Ethical, Legal and Societal Implications (ELSI) of GMOs
A: Genetically modified organisms are those in which genetic engineering techniques are used to alter…
Q: The probability of having an individual with a least a heterozygous gene pair on its genotype from…
A: The two genes are involved in this case. That's why it is a case of dihybrid cross.
Q: On May 18, 1980, Mount St. Helens experienced a major eruption that had devastating effects on the…
A: Introduction Ecological succession:- It is the process by which a specific ecology has more or less…
Q: B. The illustration shows the stages of development in human embryo. 2 CELL EGG 4 CELL EGG…
A: Introduction Life starts from single cell called zygote. Zygote is single diploid cell resulted…
Q: Which of the following is NOT a catalytic strategy used by trypsin? a. Acid-base catalysis b.…
A: Enzymes require an ideal pH range and temperature to operate properly. The tertiary structure of the…
Q: 5. 5. Draw a phylogeny the following taxa: shark; tuna; frog; lizard; mouse; whale. On your…
A: Evolution solved the challenge by developing the cellular differentiation process, which resulted in…
Q: Describe the proximity in time, similarity in timbre, pitch and good continuation? How are these…
A: Sound is defined as the vibrations that travel through the air or another type of medium as an…
Q: Homing and navigation in salmon (across developmental stages; e.g., from stream to ocean and back to…
A: Homing in migrating fishes, such as salmon, can be defined as a behavioral pattern in which an…
Q: Which statement of the cell theory is connected to an understanding of meiosis? Cells are the basic…
A:
Q: 6. Describe one major event in Earth’s natural history. The event can be an evolutionary innovation…
A:
Q: Scientists have discovered a new species of bird in Mexico that migrates South to the Amazon…
A: The process of animals migrating over great distances in search of food and shelter, as well as to…
Q: 10. Phagocytosis by a phagocyte is required for: B cell action b. helper T (T4) cell action c.…
A: Answer
Q: transport systems
A: Metabolic pathways: The reaction sequence within the organism in an orderly and regulated way is…
Q: HO HH C-N-C -C- OH R +H20 H H C-N-C N-C OH OH H. R. The chemical reaction illustrated in the…
A:
Q: Dropping Mercury Electrode
A:
Q: 4. In owl, barring (B) is sex-linked and dominant, the recessive allele (b) producing solid black…
A: According to Bartleby guidelines , we are supposed to answer first three subparts in case of…
Q: Poverty and hunger drive people to bear more children. a) True b) False 35 0
A: Not 100 % true but it true...
Q: In vertebrates, there exist a double circulation. What are these and explain each in the terms of…
A: Introduction The circulatory system pumps blood from the heart to the lungs to get oxygen, An…
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A:
Q: Activity 1: Research 5 similar species with different characteristics. Example: Gartner snakes live…
A: An organism's "niche" is defined by the collection of circumstances, supplies, and relationships…
Q: Give an example of a physiological adaptation using organs and/or tissues of an organism of your…
A: A metabolic or physiologic adjustment within an organism's cell or tissues in response to an…
Q: owl, barring (B) is sex linked and dominant recessive allele (b) producing solid black color when…
A: Sex linked Allele is present on the sex chromosome that is usually on the X chromosome. Autosomal…
Q: To describe: The ecological niche of humans.
A: The intended function that an organism performs within an environment is its niche.The biotic…
Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…
A: Introduction :- mRNA stands for messenger RNA. The nucleus uses the nucleotide sequence of DNA as a…
Q: To explain: The typical pyramids of numbers, biomass, and energy.
A: The sun provides energy to the Earth and actually defines that they're supposed to form through and…
Q: A survey was conducted for a certain trait (the ability to roll tongue or inability to roll the…
A: Introduction Hardy-Weinberg equilibrium:- It states that the genetic variation in a population will…
Suggest some possible implications of the phenomenon shown in the table (e.g. for the fishing industry or drainage basin management). Explain why these interpretations are not as reliable as the data itself.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Explain how these factors: the size of bioaerosol, inspiratory flow rate, flow pattern, inhaled volume, respiratory rate influence the respiratory degration of bioaerosols.A microorganism is grown in a fermenter under steady-state conditions. The microorganism growth follows Monod kinetics and the following stoichiometric equation: C3H6O3 +a O2 +b NH3 → c biomass + d CO2 + e H₂O Given that the biomass yield is 0.415 grams of biomass per gram of substrate, determine the respiratory quotient.Under anoxic conditions, biological denitrification of waste water by activated sludge results in the conversion of nitrate to nitrogen gas. Sludge is microorganisms, and these microorganisms carry out this reaction, this is a biological reaction. When acetic acid provides the carbon source, the reaction can be represented as follows: 5CH3COOH + 8NO3 → 4N2+ 10CO2 + 6H20 + 8HO Acetic acid Nitrate a) Is the stoichiometric equation balanced? write down the number of atoms of each species on left side and also on the right side of this equation. b) In the absence of side reactions, what is the yield of nitrogen from acetic acid in g g1? c) A certain waste water contains 6.0 mM acetic acid and 7mM NaNO3. If 25% of the acetic acid and 15% of the nitrate (NO3) are consumed in other reactions (e.g, for growth of the microorganisms in the sludge), which is the limiting substrate in the denitrification reaction? d) For the situation described in part c), what mass of gaseous nitrogen (N2) in…
- Explain in detail how these factors: the size of bioaerosol, inspiratory flow rate, flow pattern, inhaled volume, respiratory rate influence the respiratory degration of bioaerosols.Using supporting calculations, determine the energy and cost (carbon) savingsassociated with the following biological nitrogen removal strategy: Partial nitrification (oxidation of all the influent ammonia to nitrite) and partialdenitrification (reduction of produced nitrite to nitrogen gas)Plants absorb several ions and water from soil. For this reason, it is necessary for the soil to have a pH value at the range of 6.0 – 8.0. Again, if the p4 is less than 3.0 or greater than 10, then the beneficial microbes of the soil die. Normally rainwater is slightly acidic, its p# value is 5.5. During thunderstorm nitrogen and oxygen of air react to form nitric oxide, which is oxidized to form nitrogen-dioxide. This nitrogen-dioxide reacts with water vapor and forms nitrous acid and nitric acid. Acid-rain occurs because of it. 2NO2+ H2O → HNO2+HNO3 Examination of soil in a region of Rajshahi revealed that its p" value was 6.43. Nitrogen-dioxide is formed in the air because of thunderstorms, and its concentration is 0.297 ppm. What will be the difference between the p" value of the soil after rain and the lowest standard pH value ?
- Determining the surface area of biological materials is important for calculation and/or modeling of transpiration, respiration rate, soil nutrient uptake, cardiac output, chemotherapy dosage, heat transfer, etc. Using the tables from "Biology for Engineers" by Arthur Johnson (uploaded to Canvas in the Physical Properties of Biomaterials Tables file) and equations discussed in class, calculate the surface area of a Hereford bull (1106.7 lb) and compare it to that of the tallest man in U.S. history (8.0 ft 11.0 in tall and 439.0 lb according to the Guinness World Records). Quantify the comparison of surface areas rather than simply saying one is greater than the other. Reference: https://www.guinnessworldrecords.com/news/2022/6/the-tragic-death-of-robert-wadlow-the- tallest-man-ever-708849 A soil sample was taken for bulk density determination using a core sampler which is cylindrical in shape (see below). Calculate the soil bulk density, also known as dry bulk density, for a 187.4 g…The N excess/deficit factor for 100 kg of an organic material that contained 60% C (carbon) and 0.5% N (nitrogen) would likely be (assuming that 35% of the carbon is metabolized by microorganisms and the carbon and nitrogen are assimilated in a 10:1 ratio). -3.85 kg (deficit, N immobilization) -1.05 kg (deficit, N immobilization) -2.50 kg (deficit, N immobilization) -1.60 kg (deficit, N immobilization) -2.15 kg (deficit, N immobilization)I have always enjoyed eating tuna fish. Unfortunately, a study of the mercury content of canned tuna in 2010 found that chunk white tuna contains 0.6 ppm Hg and chunk light tuna contains 0.14 ppm. (S. L. Gerstenberger, A. Martinson, and J. L. Kramer, Environ. Toxicol. Chem. 2010, 29, 237.) The U.S. Environmental Protection Agency recommends no more than 0.1 mg Hg/kg body weight per day. I weigh 68 kg. How often may I eat a can containing 6 ounces (1 lb 5 16 oz) of chunk white tuna so that I do not average more than 0.1 mg Hg/kg body weight per day? If I switch to chunk light tuna, how often may I eat one can?
- The concentration of pollutant bacteria c in a lake decreases according to c = 70 e-1.5t + 25 e-0.075t Determine the time required (t) for the bacteria concentration to be reduced to c = 9 using Newton-Raphson method to within &s = 2%. Use initial guess oft= 0.Lactic acid is produced by using molasses in stirred tank bioreactor . Thermophilic bacteria (45-50 0C) are used during production. Accordingly, how is 1 L of lactic acid produced in this production process? Draw bioreactor and flowchart.Using supporting calculations, determine the energy and cost (carbon) savingsassociated with the following biological nitrogen removal strategy: Partial nitritation (oxidation of half the influent ammonia to nitrite) andanammox