cientists used a Rat6-Raf transformed cell line for the anchorage-independent growth control experiment. This cell line is transformed with an activated form of Raf. The CP788 drug had no effect on anchorage-dependent growth iwith this cell-line. Explain why this cell line was used as a control in this experiment and why no inhibition of cell growth was observed with CP788
Q: All mammals have tailbones and muscles for moving a tail. Even humans have a reduced tailbone and…
A: Evolution is the gradual progression in the inherited traits of natural populations over many…
Q: If an individual has a genotype of RR, what would be the possible genotype(s) of the gametes…
A: In a diploid organism, two alleles for a particular gene are expressed & combine to produce…
Q: If the goose with genotype aa had migrated to population 2 as shown but had failed to mate with any…
A: The transfer of genes into or out of a population is referred to as gene flow. This migration could…
Q: Remove codons 24 to 66, inclusive AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGU
A: GENETIC CODE The genetic code is the relationship between the sequence of bases in DNA and the…
Q: Figure 7.2 If a mutation occurs so that a fungus is no longer able to produce a minus mating type,…
A: Fungi is a kingdom of eukaryotic organisms that include microbes like yeast and molds and differ…
Q: Provide examples and describe basic structure/function of plasma membrane components – Phospholipids…
A: Some cells, such as unicellular bacteria and protozoa, are complete creatures; others, such as…
Q: Codons 24 to 66 represent an intron. At what point in the process of protein synthesis are introns…
A: Transcribing DNA to RNA is the initial step in a long process that finally synthesizes functional…
Q: Below is the CODING sequence of a gene. An A is inserted at position 131. Insert the variant and…
A: Introduction Central Dogma: it is the key mechanism by which DNA can be transcribed into mRNA by…
Q: What will be the phenotypic ratio of the offspring of a purebreed male fly with eosin eyes (CCXw-eY)…
A: A phenotypic ratio is a quantifiable relationship between phenotypes that shows how often the…
Q: How do microtubules act as a cytoskeleton? Are there times when they are particularly abundant?
A: A intricate web of protein filaments called the cytoskeleton is found in the cytoplasm of cells. It…
Q: Discuss at least 3 cardiovascular diseases (CVD) risk factors that can be modified. How do factors…
A: Introduction Cardiovascular diseases CVD also called as coronary artery disease is caused due to the…
Q: Discuss primate evolution before Sahelanthropus.
A: Man is the result of evolution. As a result, human evolution is intrinsically related to the origin…
Q: You isolate the mature mRNAs for each individual and run them on a northern blot. Compared with the…
A: It is a technique which is used to detect the gene expression by analysing the size and abundance or…
Q: Which of the following two organisms are most likely to have the highest degree of homology in their…
A: The relationship between DNA or structures descended from a single most recent ancestor is known as…
Q: Study the diagrams below. The diagrams represent four possible phylogenetic trees showing the…
A: Principle of parsimony: The principle of parsimony is made use of when we need to determine which…
Q: Rehpogs are mythical creatures. They are small and not very smart. Rehpogs live on the ground in a…
A: Introduction Inheritance patterns are of different type’s Mendelian inheritance, incomplete…
Q: What are the most abundant components of a plant cell walls? How do the components interact, and how…
A: Cell wall The cell wall is a non living , rigid , and the permeable structure surrounding the plasma…
Q: Describe the two kinds of reproductive isolating mechanisms and explain their role in speciation.
A: The process of speciation is how populations develop into separate species. When populations are…
Q: If you wanted PCR to be successful but only had access to a thermolabile DNA polymerase, what would…
A: PCR - Polymerase chain reaction, is a process where DNA copies are amplified by a cyclic chain…
Q: In the same cross as question #1, what fraction of the offspring will have their father's genotype…
A: Genotype The genetic makeup of a individual is known as genotype.
Q: compartments
A: A eukaryotic cell is a cell that has a membrane bound nucleus and other membrane bound compartments…
Q: What hypoth generation 0 the coefficier 1, 2, 3 and 4.
A: Consanguinity is the coupling of two people who are second cousins or even closer in relation. Based…
Q: Which of the following is not an example of artificial selection? (a) Your younger sibling got a…
A: Artificial selection is performed by humans. They try to breed the animals or plants in captivity,…
Q: Compare the homebased DNA extraction method with the Phenol:Chloroform extraction method.
A: DNA extraction: The process of extraction of DNA from the cell can be done by various methods.…
Q: Link each term with the correct definition.
A: Evolution is the gradual change in the inherited traits of natural populations over many…
Q: Which ( somatic or gametes) are made in the process of meiosis?
A: Cell cycle is a series of events that are responsible for producing daughter cells from parent cell.…
Q: Cells that line your intestines are specialized for nutrient absorbtion and are known to possess…
A:
Q: species are most broadly distributed, which have the smallest range? List at least 3 names per each…
A: Species of organisms are distributed worldwide according to their adaptation ability and the…
Q: sIMILARITIES AND DIFFERENCES ecologist vs. environmentalist
A: Differences between ecologist and environmentalist: I) Ecologists are those who study ecology i.e.…
Q: Template strand: 5' AATCATAACTCATTG 3' A. Write the CODING strand of this sequence, including the 5'…
A: Introduction : The genetic code is a collection of rules that living cells use to decode the…
Q: Which of the following statements is TRUE? RNA codes for the production of protein.…
A: Nucleic acids These biomolecules constitutes chain of nucleotides. DNA and RNA are nucleic acids,…
Q: Compare/contrast different types of cell junctions• Are they cell-to-cell or cell-to-extracellular…
A: The connection between cells is called cell junction. Cell junctions have any various kinds of…
Q: ou have surveyed three (3) populations of organisms (A, B and C) using eleven (11) quadrats of fixed…
A: Population density can be defined as the number of individuals living in an area divided by the size…
Q: List and briefly explain at least three examples of pseudoscience that are related to or attempt to…
A: Pseudoscience It involves claims made by ideas, practises, or declarations that they are true and…
Q: Compare and contrast convergent evolution and evolution by common descent, and give an example of…
A: Evolution is the process by which heritable traits change over time. There are two main types of…
Q: Which of the following will most likely contain a cofactor? Select one: a. an enzyme b. microRNA c.…
A: There are different biomolecules that are found within a living organism. These biomolecules…
Q: Discuss fully the importance of conducting studies using lab animals
A: For well over a century, the use of animals in scientific study has been a contentious topic. The…
Q: This experiment separates meat into an acetone-soluble part and an acetone-insoluble part. The…
A: Explanation: Meat has a lot of water, which is acetone soluble. Because of this, the experiment's…
Q: 3. In the absence of the channel of straight connection the activity of a contour of biological…
A: Regulation In biology, regulation means to control the process that take place inside an organism.
Q: Organisms have the following genotypes. What types of gametes will these organisms produce, and in…
A: Introduction : All sexually reproducing organisms have sex cells called gametes. The gamete produced…
Q: Suggested Study Questions: 1. What is a karyotype? 2. Explain why staining of chromosomes is…
A: Genetics involves inheritance, characteristics, DNA, genes, proteins, and chromosomes. Everyone…
Q: One of your classmates performed a gram stain on Pseudomonas aeruginosa and found variable gram…
A: The "cell wall of Gram-positive" bacteria is mostly composed of peptidoglycan layers that form a…
Q: Please answer fast Using the cDNA copies of the transcripts from parasite-cells infected with red…
A: Genes are located in an organism's DNA (deoxyribonucleic acid), and each gene governs a distinct…
Q: Antibiotics are medicines that are used to fight bacterial infections. These medicines kill…
A: Antibiotic is a medicine that inhibits the growth of microorganisms or destroys it.
Q: What is the purpose of each reagent in gram-staining? Primary stain Mordant Decolorizing agent…
A: Christian Gram devised this approach to discriminate between two kinds of bacteria based on their…
Q: Humans with gene "R" are 25% more likely to survive tuberculosis than humans with gene "S." What…
A: Tuberculosis (TB) infection is caused by the bacteria Mycobacterium tuberculosis. It is one of the…
Q: Which of the following is true of mitchondria and plastid evolution in Eukaryotes Plastids evolved…
A: Mitochondria A organelle of eukaryotic cell that performs the function of respiration.
Q: Possible answers for each: A) Both hormone and a neurotransmitter. B) Hormone. C) Neurotransmitter.…
A: Hormones only work once they "fit" a part of the body. That is, if cells within the target…
Q: (c) As for the vectors to be used for cloning and expression, suggest two types of plasmids suitable…
A: Genetic engineering has the ability to enhance the flavor of meals, boost nutritious value, and even…
Q: ANSWER BRIEFLY: Enumerate the 4 groups of coagulation factors according to function & opposite…
A: The coagulation term means the clotting of blood. The blood normally is in a liquid state, on…
Scientists used a Rat6-Raf transformed cell line for the anchorage-independent growth control experiment. This cell line is transformed with an activated form of Raf. The CP788 drug had no effect on anchorage-dependent growth iwith this cell-line. Explain why this cell line was used as a control in this experiment and why no inhibition of cell growth was observed with CP788
Step by step
Solved in 2 steps
- After a cell "clears" the G₁ restriction checkpoint, it can proceed into S phase. This S phase entry is achieved by a cyclin dependent kinase (Cdk2) and its cyclin (Cyclin E), but additionally requires the action of a protein kinase (CDC2) as well as a phosphatase (CDC25) enzyme. Explain how these 4 proteins work together to orchestrate S phase entry.Before JCVI-syn3.0 was produced, what steps were used to create a synthetic Mycoplasma cell? Put the events below into the correct order. Drag and drop the events into the proper sequence from left to right. ▸ View Available Hint(s) First Step Transformed cells are detected by the presence of lacz, which causes them to cleave Xgal and produce a blue color. Yeast is transformed using Mycoplasma mycoides fragments. The synthetic chromosome is transformed into Mycoplasma capricolum. The synthetic Mycoplasma mycoides chromosome is purified. DNA fragments assemble through homologous recombination in yeast. Reset Help Last StepThe output of RTK pathways is often the activation of MAP Kinase. Explain how MAPK can lead to activation of a specific subset of proteins, leading to distinct effects in different cell types in response to the same growth signal.
- Cellular reprogramming and induced pluripotent stem cells have allowed scientists to model various diseases and screen drugs in these in vitro models. Please select a disease that can be modeled through the generation of induced pluripotent stem cells. 1) a drug that has been screened in this disease model. Explain in detail the main findings.Gal4–VP16 requires SAGA for activation. Strains containing the Gal4+, Gal4–VP16, or Gal4–VP16–F442A activators were tested for their ability to grow on glucose and galactose as carbon sources and for their dependence on Spt20 for activation. Strains were tested for growth on SC-Leu plates containing glucose or galactose by replica plating and are shown after 4 d of growth at 30°C. The SPT20 allele and the activator present in each strain is shown in the figure. a) Describe the strain Spt20+Gal4Δ (Fig. 5B above). Is this strain able to activate the Gal genes? Why or why not? b) What is VP16-FA? please answer this fully, this is my second time posting the first time it was answered incorrectly THIS IS THE COMPLETE QUESTIONThe exchange of materials between RPE cells and the rods and cone cells is very important. Suggest by which membrane transport methods ions, proteins and damaged fragments of rod cells would be taken into the RPE cells. Outline the properties of stem cells which will help to repair the RPE layer of a patients retina after implantation of the thin sheet of cells. Outline how the presence of a base substitution mutation in the ABCA4 gene would result in the synthesis of a protein which cannot carry out its normal function. Need short answer in text solution and ASAP .
- Gal4–VP16 requires SAGA for activation. Strains containing the Gal4+, Gal4–VP16, or Gal4–VP16–F442A activators were tested for their ability to grow on glucose and galactose as carbon sources and for their dependence on Spt20 for activation. Strains were tested for growth on SC-Leu plates containing glucose or galactose by replica plating and are shown after 4 d of growth at 30°C. The SPT20 allele and the activator present in each strain is shown in the figure. a) Describe the strain Spt20+Gal4Δ (Fig. 5B above). Is this strain able to activate the Gal genes? Why or why not? b) What is VP16-FA?Which of the following small GTP-binding proteins does NOT play a role in cell migration during chemotaxis? O Cap Z Rho Cdc42 O All of the listed GTPases play a role in cell migration O Rac ◆ PreviousConsider the gal10D56 reporter gene. In 300 words or fewer, describe 1) the role of GAL7 in galactose metabolism and its importance for cell function 2) the mutation present in the gal10D56 reporter gene 3) the consequence of this mutation for GAL7 expression in wild type cells, 4) the mechanism by which certain mutations can suppress the effects of gal10D56, and 5) the specific purpose for using this reporter gene.
- According to the research article: “Telomerase Modulates Wnt Signalling by Association with Target Gene Chromatin,” how did the authors determine that TERT, Brg1, and beta catenin were all part of the same protein complex on TCF sites in vivo? Describe the assay used to determine this.Generation of induced pluripotent stem (iPS)cells was first accomplished using retroviral vectors tocarry the OSKM (Oct4, Sox2, Klf4, and Myc) set of tran-scription regulators into cells. The efficiency of fibroblastreprogramming was typically low (0.01%), in part becauselarge numbers of retroviruses must integrate to bringabout reprogramming and each integration event carrieswith it the risk of inappropriately disrupting or activatinga critical gene. In what other ways, or other forms, do yousuppose you might deliver the OSKM transcription regula-tors so as to avoid these problems?Quorum sensing controls the expression of virulencein many pathogenic bacteria. Usually, pathogens express toxins in response to receptor activation by ligand binding at high cell density. V. cholerae (thecausative agent of cholera) does the opposite; its virulence genes are expressed only at low cell densitybecause its quorum-sensing receptor is repressed byligand binding. The unusual “reversed” mechanismfor activating virulence genes in V. cholerae has suggested to scientists a simple idea for generating a newkind of antibiotic for the treatment of cholera.Explain