chrysanthemums in his greenhouse during the winter since the day length of winter was short. However, Jamie noticed a small plot of hardy garden chrysanthemums at the corner didn’t bloom. Why?
Q: Pls help sorry for the trouble. Explain the mechanism that enables a local anesthetic to work and…
A: Mechanism of Action-Local anesthetics work to block nerve conduction by reducing the influx of…
Q: The next set of questions are all related to the following operon: This figure represents the ABC…
A: Introduction:- An operon is the unit of gene expression and regulation. It consists of promoter…
Q: Which of the following are charcteristics you would expect of a circulating tumor cell that has…
A: An epithelial cell that has undergone transition into a mesenchymal cell, helps in both…
Q: The evolution of multi-cellular body plan (first demonstrated by the Porifera) probably occurred…
A: Introduction:- Organisms can be multicellular or unicellular. Multicellular organisms are made up of…
Q: Based on the following graph, the number of base pairs of a fragment of DNA that has migrated 39 mm…
A: A separation technique known as electrophoresis relies on the movement of charged species in a…
Q: a. Summarize (3-6 Sentences) any important applications of the element Nitrogen. b. Is there any…
A: Nitrogen fixation occurs when inert nitrogen gas from the environment is incorporated into lands,…
Q: Which is NOT ALWAYS true about nematodes? They have a cylindrical body. O They have longitudinal…
A: Introduction The nematodes come under the phylum Nematoda and are called roundworms. They have…
Q: When a movement occurs, which of the following brain areas is the last one to reach its peak of…
A: The voluntary movements of the body involve the motor cortex and the associated cortex region. The…
Q: If a protein is acted on by a protein kinase, in what way does that change the protein’s structure?…
A: Protein kinases play an important function in cellular activation. A key component of activation is…
Q: Examine Figure 3. Based on the number of taxa, which 2 vertebrate clades suffered the most…
A: An extinction event is rapid decrease in the biodiversity on Earth. Extinction is death of species…
Q: Examine the following pedigrees. Which is the most likely mode of inheritance of each disorder? (a)…
A: When both parents are normal and offspring is affected then it can be either autosomal recessive or…
Q: What is dosage compensation? Give its importance. explain please
A: Dosage compensation is the process of equalizing gene expression between the two sexes in organisms…
Q: make a venn diagram about the characteristics of cats and dogs.
A: Introduction : A Venn diagram is a diagrammatic depiction of ALL the potential connections between…
Q: 4. Identify and explain the type of natural selection (directional, disruptive, stabilizing) that…
A: Biological evolution is aprocess of descent with modification. Lineages of organisms change through…
Q: Report the differences you've observed between the nucleotide sequences of the different species in…
A: The process by which species adapt to their environment over time is called evolution. The…
Q: If the null hypothesis is correct, predict how the proportion of young cacti with nurse plants will…
A: The hypothesis is a supposition and explanation that is proposed. The hypothesis is made on the…
Q: Pick either the pincushion cactus or the barrel cactus. Conduct an analysis and determine whether…
A: One of the most common cactus kinds for use as succulents is the barrel cactus. It is also one of…
Q: Name three enzymes that are likely the source of bicarbonate ion that is involved with the formation…
A:
Q: Question: Which macronutrient does fermentation consume to make the fermented food a)Protein…
A: Introduction Fermentation is the process which occurs in the absence of oxygen. It is a biochemical…
Q: MULTIPLE CHOICE Question 8 Which of the following is a TRUE statement about the rock cycle? Audio…
A: Earth is made of three major layers. The innermost layer is an iron - rich solid core.The second…
Q: will it affect much or less?
A: The Bradford assay is measured at 595nm in spectrophotometer.
Q: 22. On a cold night, more flexible cell membranes will function better than less flexible ones. True…
A: Introduction:- Cell membrane is present as the outermost covering of a cell. It is made up of lipids…
Q: Which of the following mechanisms contributes to genetic variation through sexual reproduction via…
A: The genetic variation in sexual selection is achieved by random assortment of homologous…
Q: A male patient calls the office complaining of bloody urine accompanied by edema, headache, and…
A: Patients with contrast-induced nephropathy—defined as acute renal failure—present with an increased…
Q: Put the steps of a virus infecting a target cell in the right order: viral nucleic acid is…
A: The virus infects a target cell and then replicates releasing new viruses. The viral replication…
Q: Which best describes the mode of inheritance of the afflicting allele in the following pedigree?
A: The branch of biology that deals with the study of genes, heredity and genetic variations and…
Q: Several generations of population X have been studied. The dominant phenotype frequency for the…
A: The allele frequency is the rate at which a specific allele appears within a population. Evolution…
Q: a) Viruses can have DNA or RNA genes b) Antibiotics can kill bacteria, viruses and fungi c)…
A: INTRODUCTION Answers of a to l is given below.
Q: What are dietary supplements and in what situations are they "good" for you? In what situations are…
A: "Malnutrition, also known as malnourishment, is a situation caused by eating a diet that contains…
Q: The ABC operon has been altered so that some components are mutated. The genotype is: testR- testP+…
A: Operon is a unit consisting of one or more cistrons systems that function coordinately under the…
Q: B. ABO Frequencies Agora The ABO Blood Group System has one genetic locus that exhibits three (3)…
A: ABO blood group system involves the 3 alleles -A, B, and O and hence constitute the inheritance of…
Q: Which of the following is NOT required for a protein, like hemoglobin, to show positive…
A: CO2 is a regulator of hemoglobin. It binds to specific sites on the hemoglobin molecule, changing…
Q: The following mRNA is found inside a yeast cell: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ Write the…
A: Given mRNA strand: 5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ mRNA is formed by transcription from a DNA…
Q: In tomato plants, round is dominant to elongated fruit and smooth skin is dominant to fuzzy skin. In…
A: Independently assorting refers to when two genes located on separate chromosomes show independent…
Q: Silurian Rhudering nStage Ordovician Period Hirnantian Stage Rawtheya n Stage A. ascensus N.…
A: The data suggest that extinctions were brought on by climate change. This is believed to have had a…
Q: The lactose operon is likely to be transcribed when _____. A) there is more glucose in the cell than…
A: The initiation of transcription determines the regulation of prokaryotic genes. The regulation of…
Q: 1. Explain how a phenotype can increase, decrease, or have no effect on an organisms fitness.
A: In general, the term "trait" refers to a distinguishing, recognized quality that varies amongst…
Q: Growers often wrap potted plants in plastic sleeves prior to shipping. If plants remain in these…
A: Introduction : Ethylene is one of the plant growth regulators. Ethylene hormone inhibits the growth…
Q: What conclusions are there about how glucose is oxidized based on what is learned about the cellular…
A: A glucose molecule gradually decomposes into carbon dioxide and water during cellular respiration.…
Q: What are the key differences between receptor mediated exocytosis of GLUT-4 containing vesicles and…
A: COPII, COPI, and clathrin are the three primary coat proteins involved in vesicle production. COPII…
Q: ㅇㅁㅁ ㅇㅁㅁ 미이 e pedigree shown, indicate whether each of the following inheritance patterns ssible by…
A: Mutation in any of the autosomes or sex chromosomes give rise to different types of inheritance…
Q: please make a venn diagram about the characteristics of cats and dogs. PLEASE MAKE IT BROAD
A: Venn Diagram - A type of diagram that uses overlapping circles to represent the logical relation…
Q: (c) Give two symptoms of Helicobacter pylori infection.
A: Please follow step 2 for detailed explanation.
Q: How is dopamine and glutamate connectivity altered in the brains of schizophrenics?
A: In schizophrenia dopamine release is impaired. It means in schizophrenic patients the level of…
Q: The images below are of immunohistochemistry stains for E-cahedrin of ductal lobe carcinomas of the…
A: E-cadherin is one of the cadherin proteins. It has a role in cell adhesion. Therefore, its loss…
Q: 1. What are the different types of chromosomes? Draw and discuss each. 2. Discuss the following…
A: A biological process called the sex determination mechanism controls how an organism develops its…
Q: Multiple answers possible: The birth rate, b, is defined by the following equation(s): b = r + d b =…
A: Growth is a major property of a living organism. Growth is defined as the increase in number and…
Q: Using the figure, compare the processes of mitosis and meiosis. Similarities…
A: Meiosis and mitosis are kinds of cell division processes that are seen in cells. Here the parent…
Q: If you irrigate a wound with hydrogen peroxide it will bubble. What causes the bubble even if the…
A: Hydrogen Peroxide is an antiseptic that is used in the skin to prevent certain infections when there…
Jamie planted a big plot of hardy garden chrysanthemums in his greenhouse during the winter since the day length of winter was short. However, Jamie noticed a small plot of hardy garden chrysanthemums at the corner didn’t bloom. Why?
Step by step
Solved in 2 steps
- Why was this row of evergreens planted on an Indiana farm?You have been chosen as the lead student gardener for the CSUMB Future Farmers of America Club (FFAC). Your club is looking to you and your Bio211 plant experience to guide them. You arrive at the new FFAC garden plots where your club mates show you their cherry tree that they've been having trouble with. Originally, its leave would change color and fall off the tree, as expected, in the autumn. However, more recently the leaves started changing color and falling off in the spring time. Which hormone does the tree likely have in excess and why?What is wilting
- Alex thought that flower formation must be dependent on water. If this was true, he expected that the more water plants got, the more flowers they would produce. In order to test this, he obtained 200 identical petunia plants. He separated these into twenty groups of 10 plants each. He re-potted each petunia into identical containers, using the same bag of potting soil. He placed each group of plants in a large open field with no shade. Group 1 received only rain water. Each of the other groups received 10 additional ml of water, plants in group 3 received 20 additional ml of water and so on, so that plants in group 20 each received a total of 190 ml of water each evening, in addition to the rainwater. The plants were allowed to grow under these conditions for three months. When the plants bloomed, Alex recorded the number of blossoms on each petunia. Hypothesis and prediction Independent variable Dependent variable Controlled variables Control treatment So I am checking my work.…1) A student inherited a 2-hectare property but it was located near the base of the mountains so its topography was a bit rolling. He decided to plant coconut palms 10 m apart using a square planting system and with a mango tree in the middle of four coconut palms. a. How many mango trees should he buy? What do you call the system of planting with a mango tree in the middle of four coconut palms? b. Give detailed instructions to your planting crew on how to plant the polybagged seedlings that were delivered, including the basal fertilization to give the seedling a good start.Gardeners sometimes plant clover between productive growing seasons. Why would this practice be beneficial ?
- Jenny wanted to plant sunflowers, but wasn't sure of the best place to plant them on her property - so she decided to investigate! Jenny planted 6 sunflowers where they would get sun all day, 6 where they would get some sun and some shade, and 6 where they would be in total shade all day. Jenny watered all of the sunflowers at the same time of day with the same amount of water. After 3 months Jenny measured how tall the sunflowers in each location were. What is the hypothesis that Jenny was testing? Choose all that apply. Question options: A Amount of water affects plant growth B Plant growth is affected by light exposure C Plant growth is affected by the time of day of watering D Amount of light affects plant growth because light is required for photosynthesisJaden grows geraniums in his greenhouse. He has noticed that his flowers are not growing very well. The greenhouse is in the shade for much of the day and maintains a temperature of 23°C (74°F). What might be the problem and how could Jaden do to fix it?You are responsible for landscaping a very large urban park. You choose a popular flowering garden plant, the hydrangea, to plant throughout the park. The nursery you purchased the plants from said that the flowers should be pink. After a few months, though, you find—to your surprise—that the plants throughout the park display a variety of flower colors ranging from purple and blue, to pink and white, and finally, to all shades in between. After a suggestion from a friend, you test the soil where each plant was planted, and you determine that the color of the flowers seems to correlate with the acidity of the soil in which the plant was placed. Choose the answer that best fits the blank. The parentheses after the blanks are the choices. Since the flowers have shown such a broad range of colors, with no clear distinction between one color type and the next, this is an example of _________ (continuous variation, codominance, pleiotropy). The acidity of the soil is an example of…
- Let's talk about the "apriori pruning principle," if you like. Could you give me an example of this?Mang Noel and Efren are very close friends. They live in a province which main source of income relies on farming. They both own 1 hectare of rice field. Before the implementation of ECQ, Mang Noel’s son, Chris, went home for a while. One Saturday morning, Chris with his father went to the field. While roaming around, his father observed something unusual in the rice plant. The plants exhibit yellowing that starts from the leaf tip and extends down to the lower leaf portion. Going back home, they passed by to the field of Mang Efren. Mang Noel mentioned to him the unusual thing in his field. Mang Efren advised him not to worry about and to apply fertilizer. With that, Chris’ father thought that it was just an ordinary case and believed that everything will go back to normal after nitrogen application. However, Chris was not convinced so he decided to consult a plant pathologist and eventually confirmed his intuition that the disease is Rice Tungro. Based on Plant Pathology, how should…Choose one of the possible answers in the brackets to fill in the blank. During (simple dormancy/organic dormancy), seed only requires proper light and moisture for germination. During (simple dormancy/organic dormancy), the property of the seed prevents germination, even with light and moisture.