c. (i) Which enzyme in prokaryotes synthesizes the primers? On which strand (leading or lagging strand) can we see primers? (ii) Give TWO similarities and TWO differences between the syntheses by the enzyme in (i) and by the enzyme elongating a DNA strand?
Q: Some of the mammalian Hox genes have been shown tobe more similar to one of the insect Hox genes…
A: The Hox genes are a group of transcription factor genes that have a unique property: they all have…
Q: What is the flow of genetic information?
A: The flow of genetic information is always unidirectional. It is depicted in central dogma…
Q: Usually found in prokaryotes, regulatory sequences lying adjacent to the DNA being transcribed are…
A: In prokaryotes, the process of transcription and translation occur simultaneously due to the lack of…
Q: How can human females and males function normally, despite carrying different umbers of the X…
A: Each persons normally has one pair of sex chromosomes in each cell. Females express two X chrmosome…
Q: Topic: Photosynthesis Hi. I'm having trouble determining the answer to this question. I would like…
A: Photosynthesis is an anabolic process in which the carbohydrates are synthesized by using carbon…
Q: Cell membranes are composed of a lipid bilayer. How does the type of lipid bilayer affect its…
A: The cell membrane is composed of a phospholipid bilayer.
Q: CHALLENGE QUESTION I: Smurf hemoglobin has a p50 of 30 torr and has 8 subunits, instead of the usual…
A: Fractional saturation(Y) is the ratio of concentration of protein-ligand complex to total…
Q: A solution containing 3.58 x 1023 molecules/m3 of protein in water is separated from pure water by a…
A: Introduction: According to Fick's first law, the movement of particles from high to low…
Q: Which of the following glycosidic linkages is hydrolyzed by the a-amylase?
A: α amylase enzyme belongs to the enzyme group of amylase. Amylases hydrolyses the α-1,4-glycosidic…
Q: 3. snRNA is produced in transcription. 4. Initiator tRNA enter ribosome with the help of EF-Tu. 5.…
A: Transcription is the process of synthesis of RNA. The process of transcription requires RNA…
Q: Substrate A occupies the active site of an enzyme. However, inhibitor XY occupies a region in the…
A: Enzymes are catalyst which only accelarate the reactions but doesn't take part in reaction. So after…
Q: What is an enzyme and what is its function?
A: In our body, various metabolic pathways are present like Glycolysis, glucogenesis, etc. These…
Q: POST-LAB QUESTIONS 1. When a reducing sugar reacts with Benedict reagent, what organic product is…
A: 1. The Benedicts reaction with reducing sugar is given below. Reducing sugars can be either in…
Q: Identify if the following is a pyrimidine/purine nucleotide or a pyrimidine/purine nucleoside and…
A: The nucleic acids are known as polynucleotides. Monomeric units of nucleic acids are called…
Q: In the iodine clock experiment, if you increase the volume of vitamin C used, would the reaction…
A: The iodine clock experiment or reaction is the very famous experiment for the understanding of…
Q: Identify the functional groups in the following molecule as pointed by arrow A and B, then C and D
A: An atom or group of atom in the organic molecule which determines its characteristics chemical…
Q: What is unique about the use of viral gene therapy in cancer immunotherapy
A: Virus have natural ability of delivering genetic material into the cells. Therefore, some of the…
Q: The molecules of a fatty acid (for example, fit closer together than the molecules of a fatty acid…
A: Fatty acids are composed of a long hydrocarbon chain attached to a carboxylic acid group. Fatty…
Q: Why in infants idiopathic hypercalcemia occurs?
A: Hypercalcemia is a condition in which there occurs excess calcium in the serum of affected person.…
Q: Gene X is expressed in the developing brain, heart, andlungs of mice. Mutations that selectively…
A: Mutations occur as a result of errors in DNA or viral replication, mitosis, meiosis, or other types…
Q: 4. The enzyme abundantly distributed in adipocytes and germinating seeds are A. proteases B. lipase…
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: The reaction catalyzed by glyceraldehyde 3-phosphate dehydrogenase involves two "sub-reactions", one…
A: A mole of NAD is reduced to NADH by glyceraldehyde phosphate dehydrogenase, resulting in…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: 1. Is the Homo sapiens phenylalanine hydroxylase (PAH) gene encoding a non-coding protein or an…
A: Gene is a portion of the genome that can be transcribed or a functional unit of the genome…
Q: The questions ask you to identify which compounds have a specific functional group. For each…
A: Here all the compounds given are organic compounds with Carbon and hydrogen back bone structure. It…
Q: Which of the following statements concerning the enzyme regulation is CORRECT? Select one: A.…
A: Allosteric enzymes have two different binding sites. One is the active site and the other one is the…
Q: I. Effect of pH on ezyme activity pH Test tube Observation I 2 4 4 5 12 Conclusion: 8. 3.
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: All are members of the electron transport chain, except: Select one: O a. iron-sulfur center O b.…
A: The components of the Electron Transport Chain (ETC) are found in the mitochondria. During…
Q: 10. The degree of unsaturation of lipid can be measured as A. saponification number B. iodine number…
A: Saturated fats are the fatty acids in which the hydrocarbon chain with a carboxyl group contains…
Q: Question 3 N-glycosyltransferase attaches which sugar to the base oligosaccharide to synthesize the…
A: A antigen is the antigen that is important for blood grouping of individuals. Antigen A and Antibody…
Q: Chemistry A homotetramer (lacking intermolecular covalent interactions) has a native molecular size…
A: Protein structures are organized into four structural levels of organization: primary, secondary,…
Q: Tyrosine came from the Greek word "tyros" which means cheese as it was discovered in cheese by…
A: the isoelectric point of an amino acid is the pH at which the net electric charge of that amino acid…
Q: Identify the dependent variable in the experiment whose data are graphed in Figure 2. Identify the…
A: Caspases are a type of protease enzyme that plays an important part in programmed cell death.…
Q: A mixture of Alanine (pl 6.02), Glutamic Acid (pl 3.22), Glycine (pl 5.79), Lysine (pl 9.74) and…
A: Ion exchange chromatography is used to separate molecules based on their net surface charge.
Q: 8. For each of the following DNA template strands a. 3' TACGGC 5' b. 3' CCATTA 5' Determine: a. the…
A: The heterogenous nuclear ribonucleoprotein (hnRNP) is the initial step of synthesizing mRNA during…
Q: For the electron transport chain, all are inhibitors except: Select one: O a. Antimycin A O b.…
A: Most of the free energy released during the oxidation of glucose to carbon dioxide is retained in…
Q: temperature of 15 degree Celsius or lower needed for growth / optimal activity. * (Please choose one…
A: A) Thermophiles: Thermo meaning temperature and philus meaning lover , this type of organism which…
Q: Study the given structures below. Which of the following are enantiomers? * H- OH но- - H OH но- -H…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: H3C H3C. HyC O Triglyceride O Fatty acid Glycerol
A: Fatty acids are important micromolecules which combine together to form lipids in plants, animals…
Q: Break down this fatty acid. Show all the products made and the enzymes needed for any non-normal ß…
A: Fatty acids are building blocks of fats and composed of carboxylic acid with long aliphatic chain.…
Q: COMPLETE THE TABLE OF 10 STEP OF GLYCOLYSIS BY REFERRING TO THE GLYCOLYSIS PATHWAY
A: The chemica; interconversion steps, that is the sequence of reaction by which glucose is converted…
Q: D. PCR of lacZ GENE 1. You will be preparing a PCR reaction for your "G" and "L" tubes. When…
A: Given Values: The total volume of the PCR reaction tube = 50 μl The total volume of the master mi…
Q: Given Sorbitol, Briefly explain its expected reaction (based on their structural formula) to the…
A: Molisch's test is the specific test for Carbohydrates which give purple colour ring on addition of…
Q: In a glucometer, glucose oxidase catalyzes the redox reaction of glucose to form gluconolactone.…
A: A glucometer is generally a little, portable device that helps to monitor (glucose levels) at home.…
Q: You are analyzing the peptide ala-ile-glu-lys-phe-val- tyr-cys. If you treat the peptide with…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…
Q: Substrate 1 Site A Nonpolar Polar and neutral Polar and Site D Site B Polar and neutral Acidic…
A: Enzymes are usually composed of proteins and it catalyzes biochemical reactions in our body. It is…
Q: Describe how you would make 10mls of a solution with concentration: 10mM Glucose (MW-180.16g/mole)…
A: In a solution concentration of solute is reduced simply by mixing more water or by adding more…
Q: Which of the following statements best describe testing of lactose sample? Lactose will quickly…
A: Lactose is a reducing sugar made up of 2 units, one is glucose and galactose. It is made up of two…
Q: Indicate a positive result with a (+) sign, and a (-) if otherwise. A triple (+) may be used to…
A: Molisch’s test - is used to detect carbohydrates. Molisch test gives positive for all carbohydrates…
Q: a deaminating agent 5-BU is that can base-pair ike cytosine or like if 5-BU is cytosine incorporated…
A: 5-Bromo Uracil and nitrous acid are mutagenic agents. It means both of these agents cause mutation…
Step by step
Solved in 2 steps
- (d) Write down the sequences of the templates that would give the tetranucleotides shown in I and II. In each case, label the 5' and 3' ends and indicate which template base is used first. (e) What difference would it make to bidirectional DNA replication if both modes of chain extension were equally favourable? I II3. Consider the following diagrams representing three different DNA molecules. (a) 5' 3 3' 5' (b) 5' 3' 5' (c) 3' 5' Assuming that DNA polymerase is the only enzyme present and that there is no additional DNA, state whether each of these (= molecules can serve as a substrate for DNA synthesis. Give reasons as to why or why not.Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…
- 1. Describe the process of autophosphorlyation 2. Differentiate between chromosomes and genes. 3. Think about what happens at the replication fork. If the gene for helicase is mutated, what part of replication will be affected and how? 4. There are three common types of chemical changes that can damage DNA at any time post-replicatively. In basic terms, name and describe any two of the three types of damage. please help me quickMatch the enzymes provided from (1-4) in the list of choices with their matching function (A-D) during DNA replication. A. Disrupts hydrogen bonds between DNA bases B. Can only add nucleotides to an existing 3 OH end C. Can't add nucleotides to a chain, but can make covalent bonds D. Actually a specialized form of RNA polymerase select 1. DNA polymerase select 2. Primase select 3. Ligase select v 4. Helicase3b) Briefly explain what telomerase does, how it accomplishes what it does, and why that allows a cell to completely and accurately replicate the ends of linear DNA molecules. (please note that the question does not ask you to explain the entire process of replication of the end of a linear DNA strand, it only asks about the function of telomerase in this process)
- 40.Would it be possible to start synthesizing the daughter DNA strand without assembling the RNA primer first? Why? Why not? A.Yes, because the 5' PO4 is already present in the DNA strand which will be used as a template. B.No, because the RNA primer which contains the free 3' OH in its ribose has to be synthesized by primase first. C.No, because the RNA primer which contains the free 5' PO4 in its ribose will not be synthesized by primase. D.Yes, because the 3' OH is already present in the DNA strand which will be used as a template.Which statement below is true? Select one: a. Okazaki fragments are produced in eukaryotic DNA replication but not in prokaryotic DNA replication. b. In both eukaryotes and prokaryotes, the template strand of DNA is read in the template’s 3’ to 5’ direction, while the new strand DNA is synthesized in new strand’s 5’ to 3’ direction. c. In eukaryotes, synthesis of the new DNA strand is from 5’ to 3’, whereas in prokaryotes it is random. d. In eukaryotes, synthesis of the new DNA strand is from 5’ to 3’, whereas in prokaryotes it is from 3’ to 5’. e. In eukaryotes, synthesis of the new DNA strand is from 3’ to 5’, whereas in prokaryotes it is from 5’ to 3’.1. The image shown in Figure 1 below represents a strand of DNA following replication. The black lines present above the top and below bottom strands of DNA represent the phosphodiester backbone of the molecule. Examine the DNA strands and locate any sites that are damaged, mismatched, or otherwise require repair. Indicate where in the strand the specific lesion is located, and provide a detailed overview of the post-replicative repair process that would likely be used to rectify the lesion. Assume that each lesion, even those that are located in close proximity will be repaired separately. CH, CH, OCH, CH, OCH₂CH, GATCCGAATCGGCTAGGATCGGCATCCGATTCGATCGGCATCCGATCGCTAGCO CH, CH, CH, CH, CH, TACGATCGATC CTAGGATTA CCGACCCTAGCCGTAGGGTAACGTAGCCGTAGGCTAGCGACCGGGGATGCTAGCTAG Figure 1: Graphical Representation of a strand of dsDNA containing errors and damage following replication
- Which of the following statements about RNA is/are incorrect? I. RNA strand synthesis does not occur during replication. II. All RNA strands produced during transcription are translated into proteins. III. RNA strands are composed of 10 nucleotide bases per turn. IV. RNA strands can pair with a DNA strand. V. RNA may be synthesized in the 5'-3' orientation and vice-versa (3'-5') depending on the orientation of the template DNA strand O I, II, and IV O I, II, III, IV, and V O II, IV and V O II, IV and V OI, II, III and V O Il and IIIWhich of the following statements is TRUE concerning the synthesis of the leading and lagging strands of DNA in prokaryotic cells? a. O b. The leading strand is synthesized by one polymerase III continuously, and the lagging strand is synthesized by several molecules of DNA polymerase III. d. The leading and lagging strands are synthesized at the same time by the one DNA polymerase I. O c. The leading and lagging strands are synthesized at the same time by the one DNA polymerase III. The leading strand is synthesized by one polymerase III, and the lagging strand is synthesized by DNA polymerase I.3) Why are single strand binding proteins (ssb proteins) needed in DNA replication? (note that you need to explain WHY ssb proteins are important, not just what they do)