between molecules. 1. Erucic acid (22:1413) is the fatty acid that is found in rapeseed oil that was determined to be undesirable and through selective breeding, has been almost eliminated in modern canola oil. What are the B-oxidation products of erucic acid? How many ATP equivalents are required for 8-oxidation? If the acetyl CoA produced in 8-oxidation were completely oxidized in the CAC, what would be produced? Assume that all excess NADH and FADH2 is oxidized via electron transport. Based on the NADH, FADH2, and ATP produced or used above, what is the typical yield of ATP from the complete oxidation of erucic acid?
Q: None
A:
Q: 18. Name a currently unsolved problem in any of the areas we've covered so far, [pentose phosphate…
A: In the domain of plant engineering, an ongoing challenge revolves around creating crops capable of…
Q: (Biochemsitry, Topics: Glycolysis and Citric Acid Cycle) - How many ATP are formed from the…
A: The complete oxidation of fructose in the liver involves a series of biochemical reactions that…
Q: 3. What is the IUPAC name of the following compound? NH2 NH2
A:
Q: Which of the following statements accurately describes differences in beta oxidation vs fatty acid…
A: The objective of the question is to identify the accurate statements that describe the differences…
Q: Initiation of translation in E. coli requires: Question 26 options:…
A: Initiation of translation in E. coli requires several components, including:1. mRNA: The messenger…
Q: No need to upload any image just give me the answer with explanation Explanation of the incorrect…
A: Fatty acid are the compounds containing a carbon chain with one end consist of carboxylic…
Q: Draw the skeletal structure of a wax formed from arachidic acid, CH3(CH2) COOH and the alcohol,…
A: Steps to draw skeletal structure :1. Identify the reactants: The reactants given are arachidic acid…
Q: A particular reaction has a ΔG‡ of 37.0 kJ mol-1. In the presence of an enzyme, the same reaction…
A: The objective of this question is to calculate the change in Gibbs free energy of activation (ΔΔG‡)…
Q: (a) In the space below draw a free energy landscape diagram for the conversion of substrate (S) into…
A: Transition state theory states that as a substrate is converted into a product, a high energy state…
Q: Calculate the percent error for pipette P1000.
A: The pipette is designed to dispense a specific volume of liquid, in this case 1000 microliters (uL).…
Q: None
A: The statement in question relates to the process of decarboxylation in the tricarboxylic acid (TCA)…
Q: Given that the protein Burger is found only in the blood of patients with Sillyitis, with the aid of…
A: The Enzyme-Linked Immunosorbent Assay (ELISA) is a powerful technique used to detect and quantify…
Q: 2. (a) ( In contrast to the pyruvate dehydrogen- ase complex, the a-ketoglutarate dehydrogenase…
A: Approach to solving the question:Presence of Pi and Ca²⁺:When Pi (inorganic phosphate) is present in…
Q: Draw the major product of the following reaction. NH2 1. H₂O2 2. heat
A: Step 1: ReactionAbove reaction is known as "Cope elimination". Step 2: Mechanism (I) Oxidation of…
Q: 1.The diagram below shows an outline of the aminotransferase mechanism that skips the specific steps…
A: Vitamin B6 is a collective term for three biomolecules: pyridoxine, pyridoxal and…
Q: . An acetate/acetic acid (pKa=4.75) buffer of 500 mL includes 0.1 mol of acetate and 0.5 mol of…
A: The objective of the question is to calculate the volume of 2.0 M NaOH that was added to the buffer…
Q: You need to compound Aminophylline Suppositories for a patient: the density of Cocoa butter is 0.9…
A: The objective of the question is to calculate the weight of one Aminophylline-loaded suppository.…
Q: 5. Draw head group structures and name the following glycerophospholipid. a: Glycerophospholipid…
A: ### a: Glycerophospholipid that carries a net positive charge at pH 2.5.At a low pH such as 2.5, we…
Q: Which of the following molecules is most susceptible to random hydrolysis? OA. None of these; all of…
A: Random hydrolysis, the non-specific cleavage of bonds by water molecules, can affect different…
Q: 3. Following are the melting points of 18-carbon fatty acid Stearic acid Oleic acid Linoleic acid 70…
A: The question is asking to determine the number of simple and mixed triacylglycerols that can be…
Q: A student performed an enzyme inhibition reaction to experimentally determine the inhibitor constant…
A: The Dixon plot is a graphical method used in enzyme kinetics to determine the inhibition constant of…
Q: phosphofructokinase reaction of Fructose-2,6-bisphosphate is a regulator of both glycolysis and…
A: Activates glycolysis and inhibits gluconeogenesis:Increased levels of…
Q: The 5’ cap is involved in all the following except: Question 19 options: Splicing exons…
A: The processing of mRNA formed from transcription is called post transcriptional modification. Thes…
Q: 2. The diagram to the right shows the change in the structure of the C-terminal portion of each of…
A: Therefore, the final answer is: (a) Without the His146 residue, CPA-treated hemoglobin would have a…
Q: Fill in the RNA quantification table below: Sample A260 A280 A260 A280 Concentration (ng/μl)…
A: The conversion factor depends on the type of RNA being quantified.Conversion factors for different…
Q: With the advent of photosynthesis, the amount of oxygen in the atmosphere has varied over the eons…
A: Approach to solving the question:Detailed explanation:Examples:ANSWER IS 12 ML H20 Key references:…
Q: What is the major organic product obtained from the following reaction? OH OH OH OH 1. NaOH, H₂O 2.…
A:
Q: a) How does the Grotthuss mechanism and proton translocation through the membranes differ from the…
A: The chemiosmotic theory (some would argue that it is still a hypothesis and not a theory) has been…
Q: 12. What value do O-linked saccharides serve for membrane surface proteins? Which amino acid…
A: O-linked saccharides, also known as O-linked glycans, are carbohydrates that are attached to…
Q: You will have to dilute your inital Lysozyme stock in order to pipet volumes larger than 10 uL for…
A: Step 1:For the Bradford assay, the typical concentration range of protein you want to target is…
Q: Genetics Q4
A: The objective of the question is to find the sequence of the opposite strand of a given DNA strand.…
Q: The following table provides data on three popular protein supplements. (Figures shown correspond to…
A: Let the number of servings of designer whey be 'x' and the number of servings of muscle milk be…
Q: Calculate and plot the vibrational partition function of CSe2 between 500K and 1000K (with a step of…
A: Final AnswerNow, let's plot the total partition function against temperature.Explanation:Step 1…
Q: What property makes phosphatidylcholine a good emulsifying agent whereas triglycerides are not?…
A: Phosphatidylcholine contain hydrophilic head group and hydrophobic tail group.
Q: 1.(a) ( ) Trace the course of [1,6-(C-14)-2,5-(C-13)]glucose that is first processed through…
A: Approach to solving the question: (a) To trace the course of [1,6-(C-14)-2,5-(C-13)]glucose through…
Q: The image uploaded answer is not allowed please
A: Glycolysis vs. Glycogenolysis:• Glycolysis: This is a metabolic pathway that breaks down glucose (a…
Q: Consider the following Peptide: Alanine-Lysine-Glutamine-Serine-Glycine Select all that applies Give…
A: Peptides are short chain of amino acids linked by peptide bonds. Amino acids that have been…
Q: Formic acid is in the venom of some ant species. What is the pH of a 0.5 M solution of formic acid…
A: For weak acids, we can use the equilibrium constant (Ka) and the initial concentration of the acid…
Q: STEM Workplace Practices Q4
A: The objective of this question is to understand the difference between a product contaminant and a…
Q: A coal fire plant uses 1 kg of coal to generate 1000 kWh of electricity and emits 50 kg of CO2 and 5…
A: The objective of the question is to understand the relationship between the functional unit (FU) and…
Q: 3'- AATAAAAAAGGTCCCAAAAAATTAGGGGAGACGGTACATAAA GAGTAGAGTCATAAATTTTAGAGATGCGTA - 5' Table 22.4 mRNA…
A: The process of protein synthesis is also known as translation. The process of translation is…
Q: The authors in the abstract given above describe the mechanism for the activation of metallothionein…
A: Protein Phosphatase 2A (PP2A) Binding: Complexes of PP2A PR110 bind to MTF-1, the metal regulating…
Q: Draw the major product of the following reaction. Br (CH3)3N Ag₂O, H₂O heat
A: Step 1:Given 2-butylbromide and reagent 1.(CH3)3N,Ag2O,H2O,3.heat Draw the products. Step…
Q: what is balanced chemical equation for the oxidation of benzoin to benzil using sodium hypochlorite
A: ### Reactants1. **Benzoin**: This is an organic compound with two aromatic rings bonded together…
Q: 1. From the given DNA strands:a. Identify the template and non-template strand.b. Give the mRNA…
A: The answers are:(a) Template Strand:3' - G T A T A T C A G T T A G A G C T A A T C - 5' Non-template…
Q: (b)( ) In mature erythrocytes (red blood cells) the end product of glycolysis is lactate because of…
A: The table shows the rate of lactate production in hemolysates (lysed red blood cells) of human…
Q: 250 150 2 -250 150 100 -100 75 -75 50 -50 37- 37 25 20 15 10 Std Calf Fibrinogen BSA Std Biorad…
A:
Q: If instead of using the pyruvate for gluconeogenesis, the pyruvate entered the mitochondria, what…
A: The question states that if pyruvate enters the mitochondria instead of being used for…
Q: How u make it I want excel file or tell me how to make excel file now. U answered naa?? I will make…
A: The Lineweaver-Burk plot, also known as a double reciprocal plot, is a graphical representation of…
Step by step
Solved in 2 steps
- '. If oxidation of acetyl-CoA yields 10 ATPS per mole through the cit- ric acid cycle, how many ATPS will be derived from the complete metabolic oxidation of 1 mole of alanine in a mammal? Would the corresponding energy yield in a fish be higher or lower? Why? How much energy would be derived from the metabolic oxidation of I mole of isoleucine to CO, H,0, and NH3? Of tyrosine?1. Consider the oxidation of the fatty acid with the common name arachidic acid. a. Draw the structure of arachidic acid. b. How many turns of the fatty acid oxidation cycle is required for the complete oxidation of arachidic acid? c. How many moles of ATP are formed from one mole of arachidic acid if the acetyl CoA produced go to the citric acid cycle and oxidative phosphorylation? Assume 1 mole of NADH is equivalent to 3 moles ATP and 1 mole FADH2 is equivalent to 2 moles of ATP. Show how you arrived at your answer2A. Red blood cells synthesize and degrade 2,3-bisphosphoglycerate (2,3-BPG) by a detour of the glycolytic pathway, as shown below: glyeeraldehyde 3-phosphate GAP dehydrogenase 1,3-bisphosphoglycerate bisphosphoglycerate mutase ADP phosphoglycerate kinase 2,3-bisphosphoglycerate ATP 3-phosphoglycerate 2,3-bisphosphoglycerate phosphatase phosphoglycerate mutase 2-phosphoglycerate (i) The bisphosphoglycerate mutase/2,3-bisphosphoglcerate phosphatase reaction is catalyzed by a single enzyme, BPGM. At alkaline pH, BPGM favors the mutase activity while at lower pH, BPGM favors the phosphatase reaction. Use this information, along with the Bohr effect, to explain in the space below how red blood cells respond to a metabolic defect where a patient experiences chronic, elevated levels of lactic acid. I (ii) Individuals with red blood cell phosphoglycerate kinase deficiency suffer from moderate hemolytic anemia (a condition where red blood cells self-destruct before their normal lifespan). They…
- B-oxidation of a 15:0 fatty acid will result in the production of O 7 acetyl CoA, 7 FADH2, and 7 NADH O 7 acetyl CoA, 1 propionyl CoA, 8 FADH2, and 8 NADH 6 acetyl CoA, 1 propionyl CoA, 7 FADH2, and 7 NADH 6 acetyl CoA, 1 propionyl CoA, 6 FADH2, and 6 NADHFill in the blanks below (input numbers only!) about the metabolism of hexanoic acid, a fatty acid that is one of the components of vanilla, and whose formula is CH3(CH2)4COOH: First, the fatty acid is activated by attaching CoA, which costs ATP molecules. The fatty acid is then broken down through a beta-oxidation spiral, to make acetyl CoA molecules. This will require "turns" of the beta-oxidation process. Since each turn of the cycle yields ATP molecules, and each acetyl COA will yield ATP molecules by going through the rest of its metabolism, the net ATP molecules produced from one molecule of this fatty acid will bePalmitoleic acid, 16:1Δ⁹ hexadecaenoic acid, (16 carbon FA with one double bond )is an important fatty acid component of TAGs and cell membranes. Briefly explain the process of beta oxidation of this fatty acid and the number (only) of FADH, NADH and acetyl CoA outcome. What is the total ATP (only number) generated from this fatty acid after beta oxidation.
- 29. Labels. Suppose that you had an in vitro fatty acid- synthesizing system that had all of the enzymes and cofactors required for fatty acid synthesis except for acetyl CoA. To this system, you added acetyl CoA that contained radioactive hydrogen (³H, tritium) and carbon 14 (¹4C) as shown here. 3H O 14 3H-C-C SCOA 3H The ratio of ³H/¹4C is 3. What would the ³H/14C ratio be after the synthesis of palmitic acid (C₁6) with the use of the radioactive acetyl CoA?Help filling in the blanks: Folic acid is a [1/2/3] carbon carrier that can carry the carbon(s) in multiple oxidation states. S-adenosyl methionine is exclusively a [carboxyl/methyl/formyl] carrier. [TPP/NAD+/FAD/CoA] is a cofactor used to decarboxylate a-keto acids. [TPP/NAD+/FAD/CoA] activates acyl groups for transfer to other organic molecules. [TPP/NAD+/FAD/CoA] is capable of forming double bonds between carbons or disulfide bridges because it can carry electrons singly. [TPP/NAD+/FAD/CoA] on the other hand is better at oxidizing alcohols to ketones because it takes a hydride ion from a donor molecule.2 of 50 1-4. IHO OKO ONDO OX 31 H₂C-O 1. HC-O- H₂C-O O=O= 0= JONDO 3. \ 4. write your answer here 2. Following lipase-mediated separation of the three fatty acids, they are each activated through attachment to CoA and transported into the mitochondrial matrix. What is the expected total yield of ATP following complete ß-oxidation of the fatty acid labelled 3 in the image within the mitochondrial matrix? (Your answer should be a number, without any other text. E.g.: 2) I (Note, the fatty acid is already within the mitochondrial matrix. You should only consider the ATP yield from the direct steps of B-oxidation as well as that of the citric acid cycle and oxidative phosphorylation.) 00 [
- 1 The carbon skeletons of amino acids can be catabolised via various steps. These end products are often intermediates of the citric acid cycle. 100X0 0801 For example: Valine →→→succinyl-CoA Arginine →→→ a-ketoglutarate Aspartate →→→→ oxaloacetate What is the theoretical ATP yield from the catabolism of the end product of valine degradation feeding into the citric acid cycle? OND OND (Your answer should consider ATP production from the citric acid cycle up until oxaloacetate, as well as electron transport chain-mediated production of ATP. Your answer should be a number, without any other text. E.g.: 2. The image below has been provided to help you.):00:0 Acetyl-CoA NADH Oxaloacetate Malate Fumarate 1. 040 Citrate Isocitrate * a-ketoglutarate f Succinyl-CoA CO2 CO₂ NADH NET 16. 0 10:00:0ONDI NADH DOROHOI6. Phosphofructokinase is an allosteric enzyme that catalyzes the conversion of fructose 6-phosphate to fructose 1,6-bisphosphate and represents the key control point in mammalian glycolysis. The enzyme is a homotetramer that is inhibited by ATP binding, activated by AMP binding, negatively regulated by phosphorylation, and competitively inhibited by 2,5-anhydro-D-glucotiol-1,6-diphosphate. (a) Would you expect a plot of the initial rate of fructose 1,6-bisphosphate formation as a function of substrate concentration to show a sigmoidal or hyperbolic curve in the absence of any regulators? (b) How would each of the regulators above affect the dynamics of the T state to R state equilibrium of phosphofructokinase? Briefly explain your reasoning. (c) If it were possible to isolate phosphofructokinase monomers in an active form, how would you expect the kinetics in (a) to be affected? How would the rate of the reaction be affected by ATP, AMP, and 2,5-anhydro-D-glucotiol-1,6-diphosphate?…Beta-Oxidation of a 15:14⁹ fatty acid will result in the production of which of the following? 7 acetyl CoA, 1 propionyl CoA, 6 FADH2 and 6 NADH 7 acetyl CoA, 6 FADH2 and 6 NADH 6 acetyl CoA, 1 propionyl CoA, 6 FADH2 and 6 NADH 6 acetyl CoA, 1 propionyl CoA, 5 FADH2 and 6 NADH 6 acetyl CoA, 6 FADH2 and 6 NADH