Based on the following data, which bacteria is most likely a human pathogen? Bacteria E.coli S. marcescens B. Stearothermophilus S. marcescens E. coli B. Stearothermophilus None are human pathogens Absorbance Val 0.01 0.04 0.01 4 C
Q: microRNAs degrade ______________ and is an example of __________ regulation. Select one: a. DNA,…
A: Introduction and answer • A microRNA (miRNA) is a 21-24 nucleotide (nt) dsRNA.• Small RNA that is…
Q: Ch. 5: Which of the following is FALSE of laryngitis? a) it is due to infection of the epiglottis b)…
A: When the epiglottis, a tiny cartilage "lid" that covers the windpipe, expands, it is said to have…
Q: Explain why this is not true about ion channel receptors; It forms hydrophobic hollow because it is…
A: Ion channel receptors are proteins that span the cell membrane and form a pore through which ions…
Q: Scent-free zones are important recommendations because some people are very sensitive to odorants.…
A: The GOLF cascade is the cascade of signaling which is activated in response to olfactory signals or…
Q: Ch. 8: Endometriosis: a) usually leads to increased risk for uterine cancer b) may lead to…
A: Introduction : Endometriosis is a condition in which the endometrium, tissue that normally develops…
Q: 5. When two alleles are observed independently in a phenotype is called multiple alleles. Human…
A: The potential genotypes of an offspring resulting from a certain cross or breeding event are…
Q: Which structure is the the site of the synthesis of proteins that will be used inside the cell? a.…
A: Proteins are essential biomolecules composed of adjoining monomer units "amino acids" via "peptide…
Q: Multiple sclerosis is an autoimmune disease characterized by production of auto-antibodies directed…
A: Multiple sclerosis is a disease of brain and spinal cord. In multiple sclerosis, the immune system…
Q: Question 3. Which of the following dictates the number of trophic levels or feeding levels? a.…
A: Food chain is basically the transfer of energy from one organism to other in an ecosystem Types of…
Q: Ch. 6: The main imbalance in a patient with COPD is likely to be: a) respiratory acidosis. b)…
A: COPD - Chronic obstructive pulmonary disease (COPD) Is a disease caused by the inflammation of the…
Q: Give 4 similarities and 4 differences between and nature and/or role of membrane potentials in a…
A: The generation of the mitochondrial membrane potential (m) by the proton pumps is necessary for the…
Q: You have generated a new induced pluripotent stem (iPS) cell line. How would you test for the…
A: RNA-Seq can be used to determine RNA expression levels more precisely than microarrays because it is…
Q: Describe the basic process of pattern formation in segmented animals. Please expain me indded with…
A: Segmented animals are those animals have repeated oragans and there body have composed of…
Q: Ch. 5: Atelectasis could be caused by which of the following?: a) the presence of air in the pleural…
A: Introduction : The collapse or closure of a lung, which results in minimal or no gas exchange, is…
Q: Which of the following produces EPSP? OA. GABA acting on GABAA receptors O B. GABA acting on GABAC…
A: Introduction Excitatory postsynaptic potentials (EPSPs) are postsynaptic potentials in neuroscience…
Q: 44. Stress weakens our immune system and increases the likelihood we will experience certain health…
A: Malnutrition, also known as malnourishment, is a situation caused by eating a diet that contains…
Q: 4. The tension introduced into DNA by DNA helicase is relieved by: A. DNA polymerase B.…
A: Dear student, Since you have posted multiple questions, we will provide the solution only to the…
Q: which of the following is a result of colonization by mutualistic and commensal microbes? (multiple…
A: The Human body is the host of millions of microorganisms, most of which are beneficial and if…
Q: Ch. 8: Which of the following is NOT a benign condition of the reproductive system a) mastitis b)…
A: Among the given options, the correct answer can be identified as follows- C) Uterine cancer Here,…
Q: Define what the “Theory of Mind” means and explain its importance to primate social behavior.
A: Social behaviour is a kind of behaviour in which various members of the group help each other to…
Q: Pyruria is defined as... Owhite blood cells in urine O blood in urine O strong smelling urine…
A: Urine is watery filtrate containing wastes such as ions and salts along with water produced by the…
Q: A cofactor is a __________. An example of a cofactor is _________. Select one: a. protein that…
A: A cofactor is a molecule that is not a protein and aids a biological reaction. Cofactors can be…
Q: An active S-cdk (a type of CDK) will most likely _________ a. degrade cyclin b. promote…
A: CDK are cyclin dependent kinases. They control cell cycle progression. CDK bind to cyclin. CDKs…
Q: oxidized
A: e .tertiary ,oxidized The formation of disulfide bridges by oxidation of the sulfydryl groups on…
Q: can you answer in 5 simple statement please
A: Robert Koch in the 1890s gave 4 postulates to identify whether a specific microorganism is…
Q: state any 5 ways of ensuring gender mainstreaming at institutional level
A: Gender mainstreaming is the general public coverage idea of assessing the one-of-a-kind implications…
Q: natural selection
A: Evolution is change in characteristics of species over several generation and relies on natural…
Q: Which of the following is a reason that the low error rate of DNA replication is important to…
A: Some genes can withstand changes. Depending on whether it affects those genes, there may be some…
Q: What structure does the proximal tubule lead to? O O intermediate tubule O glomerulus O distal…
A: In vertebrates,Kidneys are the main oragn which involved in excretion.In each kidney,there is…
Q: different
A:
Q: Which of the following statements about carcinomas, which are tumors derived from epithelial cells,…
A: Normally, epithelial cells are a kind of cell which are found on the exterior surface of our skin as…
Q: For exponential growth to occur in a has to be population, the constant. This is unlikely if the…
A: Population growth refers to changes in the size of a given population in a certain specific time…
Q: When a neurotransmitter-filled vesicle is in the primed position, which t-SNARE connect is critical…
A: Synapses are structures or junctions that facilitate the passing of an electrical or a chemical…
Q: In this food web, who has the largest population : Mangrove or phytoplankton?
A: A food web illustrates the interconnection of different food chains that exists in a particular…
Q: polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid…
A: Wild type sequence : Met Ser Pro Arg Leu Glu Gly Mutant 1: Met Ser Pro After pro, the peptide…
Q: In a hypothetical bug population, color is determined by a single gene and black is dominant over…
A: In the absence of disrupting influences, the population will have the same constant genetic…
Q: Capacitation involves the a. inhibition of sperm maturation and activation of acrisomal…
A: Capacitation occurs in female reproductive tract. It involves biochemical changes which helps the…
Q: A D E F Terms: (not all terms/phrases will be used) Cell Wall Chloroplast Mitochondria Nucleoid…
A: Introduction Animal cells are eukaryotic cells with no cell wall. These cells contain well defined…
Q: Oocytes contain inactivated ______ that become activated soon fertilization. The mechanism that…
A: An essential step at the beginning of embryo development during fertilization is oocyte activation.…
Q: What is gene therapy? How can it be used to improve human health?
A: DNA is the genetic element in eukaryotes. The genes control the flow of information when expressed…
Q: What is the resultant ionic movement when stereocilia move towards the tallest kinocilium? Efflux of…
A: Introduction : Around the hair cells of the inner ear are two different kinds of fluid. The fluid…
Q: A kidney cell and a skin cell in the same individual will contain _____________. Select one: a.…
A: Every cell in our body (with few exceptions) has the same DNA as we start our lives as one single…
Q: 8) Where is potassium mostly found? A) in the extracellular fluid B) in the intracellular fluid…
A: Potassium is naturally found in foods and play an important role in body by maintaining normal…
Q: Suppose you learn that Mr. Smith had a stroke. Due to the stroke, his speech is NOT impaired. Based…
A: A stroke is basically a medical emergency.In stroke blood supply in the brain is interrupted.As a…
Q: Assuming each dimer binds to one unique sequence, how many unique sequences can protein dimers…
A: Proteins are biomolecules, which are made from amino acids. They are polymers of amino acids. They…
Q: Discuss three types of drug-drug interactions, and explain the links to pharmacodynamics and/or…
A: Answer : the three types of drug interactions are : drug drug interaction: the interaction…
Q: If a metabotropic (GPCR) receptor is activated, all of the following can occur except for Opening of…
A: G-proteins are activated by the binding of neurotransmitters to metabotropic receptors; they then…
Q: Sanjay's left eye has a prescription of -2.5 D, so his left eye is ________. farsighted…
A: In near sightedness, the image is formed in front of retina. These persons can see objects which are…
Q: Ch. 8: Which of the following is FALSE regarding pelvic inflammatory disease? a) It affects both…
A: In this question, it is asked find out the false statement among the options given. In the answering…
Q: The US saw great strides in public health in the 20th cut that resulted from which of following?…
A: Public health is regarded as a science that involves protection and improvement in the health of…
Step by step
Solved in 2 steps
- A boy with advanced Duchenne muscular dystrophy developedpulmonary edema (accumulation of fluid in the lungs) and pneumoniacaused by a bacterial infection. His physician diagnosed the conditionin the following way: The pulmonary edema was the result of heartfailure, and the increased fluid in the lungs provided a site wherebacteria could invade and grow. The fact that the boy could notbreathe deeply or cough effectively made the condition worse. Howwould the muscle tissues in a boy with advanced DMD differ from themuscle tissues in a boy with less advanced DMD?Hepatitis B Virus is 42nm in diameter. Sacromyces cervisiae (a yeast) has a diameter of 4um in length. Staphylococcus aureus (bacteria) are 0.001mm in diameter. Put the three microbes in order from smallest to largest. Hepatitis B, S. cervisiae, S. aureus Hepatitis B, S. aureus, S. cervisiae, S. aureus, Hepatitis B, S. cervisiae, S. cervisiae, Hepatitis B, S. aureus S. cervisiae, S. aureus, Hepatitis B, S. aureus, S. cervisiae, Hepatitis BA patient has bloody diarrehea and takes left over penicllin in a medicne cabinet. The culprit causing the infection turns out to be E. coli of a hemorrahgic variety that is Penicllin resistant. Why is the patient is worse condition now?
- Propionibacterium acnes is a normal member of the skin microbiome that benefits the body by lowering the skin's pH- an antimicrobial effect. However, P. acnes is also the leading cause of acne. Explain mechanistically how can a bacterium be normal and beneficial but also be pathogenic?Match the description listed below to the correct bacterium. Grows in intestine of ruminants like cows. [Choose ] Can be found in raw milk. If ingested, can cause spontaneous miscarriage in women, neonatal sepsis and meningitis [Choose ] Listeria monocytogenes_ Can grow in high salt environments. Makes a Staphylococcus aureus_ heat stable enterotoxin Campylobacter_ When the toxin this pathogen makes is _Vibrio cholerae_ ingested, can cause "projectile vomiting" Streptococcus pyogenes_ Can grow as a mesophile in humans, but also can grow as a psychrophile in refrigerators [ Choose ] A leading cause of food-borne infections, grows on fecal contaminated raw poultry (e.g. raw chicken), forming a biofilm. A [Choose ] microaerophile Question 41 How can Clostridium tetani survive in aerobic environments?A student argues that it makes no sense to be concerned about coliforms in drinking water because they are harmless members of our normal microbiota. Explain why regulatory agencies are concerned about coliforms.
- In July 2015, a report was released indicating the gram-negative bacterium Pseudomonas aeruginosawas found on hospital sinks 10 years after the initial outbreak in a neonatal intensive care unit. unit. aeruginosa usually causes localized ear and eye infections but can cause pneumonia or septicemia in vulnerable individuals like newborn babies. Explain how presence of this reported P. aeruginosa could lead to a recurrence of nosocomial disease. Would infection from this pathogenic species be considered a primary or opportunistic?Which aspects of a microbial disease make it more likely to cause an outbreak? In other words, what advantages do these microbes have that others do not? Use an example of at least one outbreak in your description. 2. What measures are taken in the United States to prevent outbreaks from occurring? 3. What disease not prevalent in the United States do you think has the potential of causing a major outbreak in the United States? Name at least one reason to support your assertion.This is a figure from a recent paper comparing different bacterial pathogen strains. What is being compared in this figure? 810 820 830 ATCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCT GGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC AGCAAACAGGATTAGATACCCTGGTAGTCCACGC ATCAAACAGGATTAGATACCCTGGTAGTCCACAC Staphylococcus aureus Staphylococcus epidermidis Enterococcus faecalis Streptococcus pneumoniae Escherichia coli Enterobacter cloacae Klebsiella pneumoniae Pseudomonas aeruginosa Haemophilus influenzae Bacteroides fragilis Polypeptides Proteins DNA RNA Amino acids
- write a brief summary on the KPC bacteria, What clinical significance does this organism have for humans? (What disease/infections does it cause in humans?) What is the mode of transmission to humans? (How do you get an infection with this organism?) What is the worldwide geographic distribution for this organism? (Where is it found, have there been any reported cases or outbreaks lately?)ITEM MSM MICROBIAL PROFILE I MICROORGANISM/CAUSATIVE AGENT A GRAM REACTION B OXYGEN REQUIREMENT с SIZE D SHAPE E HABITAT F DISCOVERY G MICROSCOPIC IMAGE DISEASE PROFILE DISEASE/S SYMPTOMS OF THE DISEASE с INCUBATION PERIOD D MODE OF TRANSMISSION E DIAGNOSIS F TREATMENT G PREVENTION H NO OF DAYS BEING SYMPTOMATIC I IMAGE OF INFECTED PATIENT HABCO А BACTERIA: Haemophilus ducreyi PROFILE Haemophilus ducreyiWhich of the following is a comma-shaped, Gram-negative bacterium that acts as a predator on other Gram-negative bacteria, and might be used to control populations of Gram-negative human pathogens in locations such as poultry farms? O Norovirus OBdellovibrio O E coli Vibrio choeroe O Salmonella enteritidis DQuestion 42