B. Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a transition leading to a silent mutation in the second amino acid. Bold or underline the nucleotide that has been changed
Q: 15. Why might people need another SARS-CoV
A: A brand-new coronavirus called SARS-CoV-2 initially appeared in Wuhan, China, in December 2019. It…
Q: Name the roles that Anaphase Promoting Complex protein plays.
A: The Anaphase Promoting Complex (APC) is a multi-subunit protein complex that plays a crucial role in…
Q: In order to investigate the cell cycle in HEK293 cells in culture, I ran a flow cytometry…
A: Flow cytometry It is defined as a technique that is used to analyze single cells or particles as…
Q: The ‘mushroom’ of club fungi is the ____ of these organisms. spore hypha mycelium yeast fruiting…
A: The question focuses on understanding the structure and life cycle of club fungi, specifically, the…
Q: Give typing answer with explanation and conclusion 1. Is it harder or easier to find the genes for…
A: Polygenic traits are those that are impacted by several genes as opposed to just one. Environmental…
Q: Exercising did not have any added value on the BDNF level in MS patient compared to mitoxantrone…
A: MS stands for Multiple Sclerosis, which is a chronic autoimmune disease of the central nervous…
Q: Antibody-dependent cell-mediated cytotoxicity would be an important adaptive immune response to…
A: Antibody-dependent cell-mediated cytotoxicity (ADCC) is an important adaptive immune response that…
Q: The results shown in the accompanying graph support the hypothesis that Toll protein is necessary…
A: Drosophila Melanogaster is commonly called fruit flies and belongs to the group Arthropoda. It is…
Q: _______ is when the phenotype of the offspring does not reflect its genotype but rather that of the…
A: Genotype refers to the genetic makeup of an individual, including all of the inherited genes that…
Q: Question 7. When does differentiation occur in sperm development?
A: In the seminiferous epithelium, a complicated series of morphological changes are involved in sperm…
Q: Glomeromycete fungi and plants take part in a mycorrhiza that ____. benefits the plant, but harms…
A: A recent phylum called Glomeromycota has roughly 230 species that are closely related to plant and…
Q: Ergogenic aids/Supplements: Good or Bad?
A: A method used to improve performance can be widely referred to as an ergogenic aid. The most…
Q: The term ____________ defines the range of expression of a mutant genotype within a population.…
A: Mutant genotype is DNA mutation which are acquired rather than inherited. In case of cancer mutation…
Q: 48-72 hours after birth, the breasts produce ________, a substance rich in protein and…
A: Pregnancy is the period in which the fertilized egg develops into a baby inside the womb of the…
Q: Why the cells are capable to maintain the homeostasis? 5.- Please name the organelles in the…
A: Cells are the basic building blocks of life, and they must maintain homeostasis in order to survive.…
Q: Analyse the data. Which bacteriophage (A,B,C)should use in the mutagenesis experiments and why?
A: To determine which bacteriophage to use in mutagenesis experiments, we need to consider both the…
Q: Leaf color in plants is due to the chloroplasts and the amount of chlorophyll they contain. The…
A: Chloroplasts are organelles found in plant cells that are responsible for photosynthesis, the…
Q: What are proto-oncogenes, oncogenes, and tumor suppressor genes and what is their involvement in…
A: As we know that a normal cell undergoes repeated division, differentiation, and apoptosis, and when…
Q: Remaining Time: 43 minutes, 54 seconds. * Question Completion Status: QUESTION 1 One difference…
A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…
Q: A mutation resulting in a premature stop codon may result in which of the following: A) A shorter…
A: Mutations can arise in cells of all types as a result of a variety of factors, including chance. In…
Q: Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a…
A: A missense mutation is a type of point mutation where a single nucleotide change in the DNA sequence…
Q: Api 12 at 6.35am Instructions Question 11 The descending limb of the nephron loop pulls water into…
A: Kidneys are the excretory organ in human that perform elimination of metabolic nitrogenous waste…
Q: Name two cell functions regulated by DAG and IP3
A: The majority of chemicals that cause cell signalling are those that attach to a particular protein…
Q: are hallmarks of cystic fibrosis. Chronic bacterial infections of the intestine Buildup of mucus…
A: Cystic fibrosis (CF) is a genetic disorder that affects various organs in the body primarily the…
Q: What information does the pain receptor relay to the brain about stimuli BELOW threshold 1)The…
A: Receptors are essential as they help us feel and react to things both inside and outside our bodies.…
Q: Is there any potential to overdose on caffeine? How can caffeine overdose be prevented?. What's the…
A: Caffeine is a naturally occurring stimulant that is found in many foods and beverages, including…
Q: high-leve 8. Why is hydrogen peroxide used to clean a puncture wound? uld be needed? Medium-level?…
A: A wound is a physical injury to the body's tissue caused by an external force. It can be caused by a…
Q: What are the symptoms of intoxication as well as withdrawal symptoms that come with heroin abuse?
A: Heroin is a black, sticky ooze or a white, brown, or brown powder. It is an opioid medication…
Q: You find a fungus in a stream. In your water sample there are also cells that look like spores but…
A: Fungi are a diverse group of organisms that are classified in their own kingdom, separate from…
Q: 1. Which statement is most correct regarding the difference between mitosis and meiosis? Meiosis can…
A: Mitosis is a process where a single cell divides into two identical daughter cells, whereas meiosis…
Q: (melanocortin-1 receptor) Coat color in black bears is controlled, in part, by the Mclr locus. At a…
A: An allele is a variant form of a gene that arises by mutation and is located at a specific position…
Q: Question 33 Which of the following are structural modifications in the small intestine that function…
A: Cholesterol is a critical component of plasma membranes: Cholesterol is an important structural…
Q: Leaves can grow anywhere on a stem. True False All of the shoot tissues are generated by…
A: Plants are multicellular organisms that belong to the kingdom Plantae. They are characterized by…
Q: leaflets but those are not single leaves. True False Match the common plant leaves to the…
A: leaflet (occasionally called foliole) in botany is a leaf-like part of a compound leaf. Though it…
Q: How can we use human pedigrees? What can you determine from reading a pedigree, for example can you…
A: Genetic traits are passed down through inheritance from parents to their offspring, who receive all…
Q: The characteristics that genes express, whether they are physical, behavioral, or biochemical, are…
A: Genetics is the study of genes and their consequences on an organism's features and characteristics.
Q: DNA fingerprinting is now widely used to tie a particular suspect to the DNA samples found at a…
A: DNA stands for Deoxyribonucleic Acid. It is a molecule that carries genetic information and is found…
Q: what about the neurofascin?
A: A mutation is a change in a gene's DNA sequence that can lead to the production of a misfolded or…
Q: Which statement about transposons is INCORRECT? a.A transposon is a small fragment of DNA that…
A: Genes make proteins, which are important for our body to work properly. That's why it's really…
Q: Jessie is working with a 100% stock concentration of Clorox. She decides to add 100 μL of bacteria…
A: For calculating the unknown concentration of the tube we will be using the formula as mentioned…
Q: Please draw all of the structures of the intermediates and names of all reactants, intermediates and…
A: Almost all sorts of organisms have evolved a metabolic process and anaerobic energy source called…
Q: In a previous study, Dombrowski et al. [44], has reported that Treg cells are able to promote…
A: The immune system of the body is the defense system that aids in the protection of the body as well…
Q: What happens to the stratum functionalis of the endometrium during menstruation? Group of answer…
A: The endometrium is a glandular tissue that lines the inner uterine wall and undergoes periodic…
Q: Write a brief and concise summary of the relative polarities of the chlorophylls, carotenes, and…
A: Understanding the polarity of biological molecules is essential for studying their chemical…
Q: Gross and Microscopic Ⓒ2022 Chamberlain University LLC. All rights reserve distribution without the…
A: The ear is a complex and intricate sensory organ that is responsible for detecting sound and…
Q: how calcium stored in the cardiomyocyte SR?
A: Cardiomyocytes are specialized muscle cells that make up the majority of the tissue in the heart.…
Q: Describe the mechanisms by which microfilaments assemble.
A: The cytoskeleton is a network of protein filaments that provides structural support, shape, and…
Q: The gene known to be mutated in cases of Agammaglobulinemia 2 (which is inherited in an autosomal…
A: Agammaglobulinemia refers to a collection of inherited immune deficiencies that are characterized by…
Q: Write a brief description of any one "diet" (paleo, for example). Will this diet provide the body…
A: The paleo diet also known as the Paleolithic diet or caveman diet is a dietary approach that is…
Q: for the organism Polyommatus eleniae Use this link to answer the following:…
A: Polyommatus eleniae, commonly known as the silvery blue butterfly is a species of butterfly in the…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.position position (5' end) position (3' end) UUU Phe - F UUC Phe UAU Tyr Y. UAC Tyr UAA Stop UGU Cys UGC Cys UGA Stop UGG Trp UCU Ser UCC Ser U UUA Leu UUG Leu UCA Ser UCG Ser UAG Stop W 輔 CAU His CGU Arg CGC Arg CGA Arg CGG Arg CUU Leu CCU Pro CUC Leu CCC Pro P. CCA Pro CÁC His CỦA Leu CAA Gln CUG Leu CCG Pro CAG GIn AUU lle ACU Thr AAU Asn AGU Ser AUC lle ACC Thr -T ACA Thr AAC Asn_ AGC Ser AGA Arg AGG Arg A AUA lle AAA Lys EK AAG Lys AUG Met ACG Thr GUU Val GGU Gly GGC Gly GGA Gly GGG Gly GAU Asp D GAC Asp GCU Ala GUC Val -V GUA Val GCC Ala GCA Ala GCG Ala G - A GAA Glu FE GAG Glu GUG Val Nonpolar Polar Basic Acidic Stop codon Table 4.1 Biology: How Life Works, Third Edition © 2019 W. H. Freeman and Company Consider the DNA sequence–3'-CACTGGTAGCGA–5', • What is the sequence of the messenger RNA sequence that is transcribed from this DNA sequence? (Indicate the 5' and 3' ends of the RNA molecule.) • Consult the genetic code that is shown above. What is the amino acid sequence of the…Genetic Code-Reference Second Letter First Letter C Third Letter UAU] UACS **UAA Stop UGU] Cys UGC U UUU Phe UUC UCU Туг UCC U Ser UUA) Leu UUG **UGA Stop UGG Trp UCA UCG **UAG Stop CUU CCU CAU) CGU His CACJ CAA) CUC CCC CGC Leu Pro Arg CUA ССА CGA A Gln CUG CCG CAGJ CGG AAU] AGUSer U AUU ACU AACAsn AAA Lys AUC Ile ACC AGC C Thr AGA] Arg AUA ACА AAGJLYS GAU] GACASP *AUG Met/Start ACG AGG U GUU GCU GGU Asp GUC GCC GGC Val Ala Gly GAA) Glu GAGJ GUA GCA GGA GUG GCG GGG
- The sequence shown in Figure 2 is the nucleotide sequence of a heat shock protein of Bacillus anthracis obtained from the NCBI database. >NC_005945.1:2107825-2108262 Bacillus anthracis str. Sterne chromosome ATGCGTAATTTATTTCCAGAAATAACAAAACGTCAAAATGGTATTTTTGATTTTGGACCTTCTTTATTAG AAGGGATGACAGATGCTTTCTTTAAACCGATGAACATGGATATTTTTAAAGTAGATGTTCATGAACAATC TGATAAATATACAGTGAAAGCAGATTTACCAGGTTTTCAAAAAGAAAACATTCAAGTTGAATTTGAACAA GATGTATTAACGATTCAAGCAACTAATCATAATGAAGTAGAAGAAAAAAATGAGAATGGCACATATATTC GTAAAGAACGTTCTATAGGTTCTGTAACTCGACGTTTTAGTTTTAAACAAGTTGAGGAAGAAAATGTTAG AGCGAATTACAAAGATGGCGTGTTGACAATTGAATTGCCAAAATTGAAAGAAGAAAAAAACAGTAAAACA ACAATTAATATTGAATAA Figure 2 (i) Is the nucleotide sequence above translatable into a complete protein? Justify your answer. (ii) Is the sequence above represented in the standard FASTA format? Explain your answer.what is the anticodon sequence that would build this protein? AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGUUGUAUUUGGUUUGUGGCGAGCGCUUUUACCAGUUAGAGAAUUACUGAIn the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash between each group of three bases. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG
- GAG Glu GGG Use the genetic decoder provided to assist in answering this question.\ Second letter UGUT UGC Cys Stop UUU UTo UCU UAU Tyr ULIC Phe UACJ Ser UCC UAA Stop UGA A UAG Stop UGG Trp G UUA nan onn UCG OLeu UCA CAU CGU) CACHS Pro CAA CUU CCU His C CUC Leu C CUA LEUCCA ) Gin CAGJ CGA Arg CUG CGG ACU AAULAso AGUser AUU AUC le AUA AUG Met ACG ACC ACA The AAA AGA AAGJ AGG JArg 6 FLys GAUAn GU GUU GUC GCU GCC Asp Val GUA GAC Ala GAA Glu GAG GGC A Gly GGA GGG GCAA GUG GCG What do you predict would happen if you created a tRNA with an anticodon of 5'-AGG-3' that is charged with methionine, and added this modified tRNA to a cell-free translation system that has all the normal components required for translating RNAS? We did one like this in class... we have to think'about the directionality (5' -> 3' or 3' -> 5'). The easiest way is to draw out your anticodon and codon first, and then consider are the strands going to line up parallel or anti-parallel. O a. methionine would be…Place sequences a, b and c into the correct order based on start and stop codons. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence B TCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTC AATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTC GCGCCGAAAAAGATATGGDNA within a prokaryotic cell is found in a(n)
- If we have the following mutations, find the type of the mutation (silent or missense or nonsense?) 17C=U 36G=A 49G=U 115A=C 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’This is a paper centrifuge: (you don't need to watch the whole video, just a few seconds to see how it works--description below is probably sufficient if you can't get to the link) https://www.youtube.com/watch?v=isMYGtCFljc It is a paper disc that has supercoiled strings through two holes in the centre--like a button. As you straighten the strings and uncoil them, the paper spins. The paper spins at a very high rate and can separate materials in a way that is similar to a centrifuge. A droplet is added to the centre of the paper and it is spun. The densest objects travel the farthest from the centre. Assume that we are using it to perform our mitochondrial extraction, which cellular component would travel the furthest? nuclei mitochondria microvessicles blood cellsFind 5’ UTR and 3’UTR of Mrna 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’