Q: Which of the following is NOT true of stabilising selection a. it occurs when inidivuals with…
A: Introduction EVOLUTION : The series of events that occurs from the generations to generations for…
Q: Why are hydrogen bonds and van der Waals interactions necessary for cells?
A: Hydrogen bonds are a type of bond which is an electrostatic force of attraction between two hydrogen…
Q: Hypothesis are testable and falsifiable explanations for one or more observations. What does it mean…
A: Introduction: A hypothesis is a logical assumption backed up by evidence. This is the first step in…
Q: reason why open system has a limitation of collecting only 10 mL of blood?
A: Open and closed collection are two methods of collecting blood samples for lab testing. 1. Closed…
Q: 46.2 degrees Celsius. The proteins inside the bacterium resist denaturation at the human body's…
A: Introduction Salmonella typhimurium is a gram negative bacteria. It can colonize the intestine of…
Q: Select two items that biologists agree are necessary in order to consider an organism "alive." For…
A: There are primarily two categories of objects in the universe: living things and non-living things.…
Q: Initially, the solution in side A, with respect to that in side B, is what? After the system…
A: Introduction Water potential is the measure of the tendency of water to move from one to another…
Q: What are the most common benign bone tumors of children?
A: Bones are the important tissues of the body which give a structural framework to the body. The long…
Q: Don't copy from Google ASAP
A: We know that The system helps in the breakdown of large and complex food particles into smaller and…
Q: __4 Need to complete..
A: We know that The gaseous exchange takes place in the lung alveoli. It is where oxygen present in the…
Q: The ___________ is the basic unit of life.a. organism b. cellc. tissued. organ
A: All the living organisms are made up of cells which forms the basic unit of life.
Q: Lungs contain more elastic fibers than collagen fibers.
A:
Q: Cellulose and starch are examples of ________. a. monosaccharides b. disaccharides c. lipids d.…
A: Carbohydrates are sugar molecules that consists of carbon, hydrogen and oxygen. They are the energy…
Q: When the skin is exposed to sunlight it will produce: Calcium Vitamin D Vitamin C Vitamin D…
A: Vitamins are essential constituents of food other than carbohydrates proteins and fats required in…
Q: 111. Which of the following best describes the relative quantities of the subunits of hemoglobin in…
A: Type of hemoglobin Adult Hb(Hb A)= 2 alpha and 2 beta subunits HbA1 is the major form of Hb in…
Q: List the secretions of the pancreas, liver, and gallbladder.
A:
Q: Effect of DNA Mutations on Protein Structure & Function The structure of a typical human protein…
A: Introduction A mutation is a modification to the DNA sequence of an organism. Mutations can result…
Q: List the events occur at the neuromuscular junction.
A: Introduction The NMJ or the neuromuscular Junction is the site of synaptic connection between the…
Q: What lesions are typical of atopic dermatitis in children?
A: Atopic dermatitis is characterized by pruritus which is itching of the skin. The main symptom is a…
Q: 6:50 Write a 2-4 paragraph answer on how you would use your brain to play a musical instrument. Must…
A: The brain is an important organ of the body. It is covered by the protective bony covering called…
Q: Centigram The centigram is the smallest unit of weight. True or False True False
A: The weight of a person or any object means how heavy is that. Weight is defined as a quantity…
Q: Discuss the clinical manifestations of Duchenne muscular dystrophy.
A: Duchenne Muscular Dystrophy( DMD) Children may have difficulties walking or rising from a seated or…
Q: What are the limitations of UV Visible spectroscopy and fluorescence spectroscopy? Include reference…
A: Spectrophotometric analysis has been widely used in biomedical science to determine the…
Q: Medical Technologist should know the basics of Osmosis, Diffusion and Emulsification processes?
A: Definition Osmosis is a process by which the substances(liquid) from a region of low concentration…
Q: B. For numbers 8-10, write True if the sta 2-11e5-ignut 8. Ribosomes, the main organelle involved in…
A: Note: sorry, Please note that as per our company's honor code we cannot attempt an essay. Please try…
Q: Describe the two layers of the skin.
A: Skin is the largest external organ of our body that forms a external protective layer and protects…
Q: The electron shells in an atom of silicon (atomic symbol Si) each
A:
Q: define the term science
A: Introduction The scientific study of life is known as biology. Although it is a natural science…
Q: Describe rubella and rubeola.
A: Rubella- It is a viral infection which is also called German measles or three day measles. It is a…
Q: What risk factors and clinical findings are associated with pyelonephritis?
A: An unexpected and serious kidney infection is known as acute pyelonephritis. The swelling it…
Q: whats the answer??
A: There are different microscopes are designed for different purposes. Some are made to view miniature…
Q: ectron When studying pancreatic cells und microscope, structures were found that divide the cell-…
A: Introduction An animal cell is covered by plasma membrane and it contains cytoplasm, nucleus and…
Q: Uncommon unit of length in the metric system Which of the following is NOT a commonly used unit of…
A: Introduction: Different systems measure length using different units: The symbol for the length unit…
Q: Which characteristic is a disadvantage of hydroelectric plants? O Low net energy O Large land…
A: Introduction Conservation biology is that the study of the conservation of nature and of Earth's…
Q: 1. Draw and label the Important parts of a hypothetical cell. 2. Enumerate the 2 major classes of…
A: Introduction An organelle is a subcellular structure that, like an organ in the body, has one or…
Q: How are chickenpox and herpes zoster related?
A: Chicken pox is the infection in which rashes develop which are quite itchy in nature, while herpes…
Q: Describe the incidence and types of child maltreatment or abuse.
A: Maltreatment is the word that tells the quality of care any child receives while the word abuse is…
Q: Temperature conversion II
A:
Q: The monomers that make up proteins are called_________.a. nucleotidesb. disaccharidesc. amino…
A: Proteins are the polypeptide chain, which folds into a three dimensional (3D) structure to…
Q: The genotype of the individual with the arrow is O O A) Aa B) Xaya C) xAxa D) aa 10 마음 게
A: Inheritance or heredity is passing on one trait from the parents to the progeny by either asexual or…
Q: 4. A researcher suggests that small doses of hyaluronic acid (HA) will promote the uptake of water…
A: A hypothesis is an assumption that is made based on some evidence.
Q: 16 Which of the following correctly identifies a part of the human ear and its function? A. B. C. D…
A: Introduction : The cochlea is a long, coiled outgrowth of sacculus. It is the primary organ of…
Q: True or false
A: We know that The nervous system is the major system that coordinates and controls the body. It…
Q: Carbon, hydrogen, and oxygen from sugar molecules may combine with other elements to form other…
A: Introduction Biomolecules are substance that is produced and required by biological organisms for…
Q: Q3.6. The farmer's experiment was widely considered to be well-designed and well-implemented. After…
A: Given information The harvest of blackberries is lower than usual. The farmer suspects that either…
Q: What is the characteristic lesion of erythema multiforme?
A: Erythema multiform (EM) is a skin condition that is characterized by the presence of red, raised…
Q: Enzyme and products Enzyme and substrate complex
A: Introduction Enzymes are the molecules that catalyze biochemical reactions, while a catalyst is a…
Q: Q3.3. What are the independent (treatment) and dependent (response) variables in the farmer's…
A: The original research and analysis are referred to as primary analysis. The secondary analysis has…
Q: How many lions do you think there are in 1960 and in 1975?
A: There is continuous drop in lion population and experts estimates that the total population of lions…
Answer in point. Should be correct. Else
Step by step
Solved in 2 steps
- PUC18 (Figure 2) is a plasmid cloning vector commonly used with Escherichia coli (E. coli). Eco01091 2674 Plol 46 BstAPI 179 Aatil 2617 Sapl 2501 Ndel 183 Ehel 235 Pdml 2204 MCS lacz 146 Bogl 2215 Scal 2172 2486 PUC18 2686 bp Bsaxi 659 Sapl 683 AlMI, Pscl 806 Gsul 1784 1626 Cfriol 1779 Eco311 1766 Eamt 1051 1094. 1466 rep (PMB1) \BseYl 1110 \Cail 1217 Hincl Ctr Eci136 Psti Acc65 EcoRI Eco24 Saci Sall EcosBi Xapl 455 M13puC sequencing prier (20). 17mer 399 Hindi SG TAA AAC GAC GGC CAG TGC CAA GCT TGC ATG CCT GCA GGT CGA CTC TAG AGG ATC CC GGG TAC CGA GCT CGA ATT CGT 3'CATT TIG CTG CCG GTC ACG GTT CGA ACG TAC GGA CGT CCA GCT GAG ATC TCC TAG GGG CCC ATG GCT CGA GCT TAA GCA Lacz -Val val Ala Leu Ala Ser Ala His Arg Cys Thr Ser Glu Leu Pro Asp Gly Pro Val Ser Ser Ser Asn Thr Pael Sdalvel Bam Smal Kont Xmil Xbal AAT CAT GGT CAT AGC TGT TTC CTG 3 TTA GTA CCA GTA TCG ACA AAG GAC S le Met Thr Met MSpic reverse sequencing primer (2). 17 mer Figure 2 X1 gene was inserted at the HindlII and EcoRI…You are interested in cloning a gene that codes for an enzyme that produces a blue pigment. You have chosen to use the plasmid pUC19 for cloning (shown below). Drdl 91 Acll 2297 Xmnl 2294 Bcgl 2215 Scal 2177 Pvul 2066 Avall 2059 BsrDI 1935 Acll 1924 Fspl 1919 Avall 1837 NmeAIII 1822 Bgll 1813- Bpml 1784- BsrFI 1779 Bsal 17661 BsrDI 1753 Bmrl 1744 Aatll - Zral 2617 BriVI 2542 Sspl 2501- BsMBI 51 BsmBI 2683 Eco01091 2674 Ahdl 1694 PUC19 2,686 bp BceAl 1292 ori BstAPI 179 Ndel 183 Kasl - Narl - Sfol 235 Bell 245 Fspl 256 laczo AlwNI 1217 Pvul 276 Pvull 306 Bmrl 364 BseYI 1110 BceAl 387 MCS BeiVI 1015 Til 781 AflIlI-Pcil 806 Drdl 908 Apol-EcoRI 396 Banll - Sacl - Eco53KI 402 Acc651 - Kpnl 408 Aval-BsoBI- Smal- TspMI-Xmal 412 Bamil 417 Pvull 628 Tfil 641 BsaXI 659 BspQI-Sapl 683 Xbal 423 Accl - Hincll - Sall 429 BspMI-BfuAl 433 Sbfl 434 Pstl 435 Sphl 441 HindIII 447 The plasmid codes for three elements, lacZ, ApR and ori. What are these three things? Which restriction enzyme cut sites would…In biotechnology, gene cloning is a crucial technique used in many genetic modification experiments. A vector is normally required to perform this process. The vector commonly used to transform a bacterial host cell is known as a plasmid. Below is the general plasmid map of pBR322. Elaborate the functions of ori, Ap and TeR present in pBR322. Bul 3759 Prul 3733 PM 3507 BDI 3602 Asel 3537 Bal 3433 Finci 3905 Scal 3844 3787 Bad 3420 Ahdi 3361 Acul 3000 AlwNI 2884 Sspl 4168 Earl 4155 Acul 4048 Xust 3961 Bell 2777 Bc1 2682 ori Aall-Zeal 4284 BeiVI 4209 B 4205 Del 2575 Pail-Att 2473 BAB 2404 EcoRI 4350 Earl 2351 BspQI-Sapl 2350 Ndel 2295 BAP 2291 178-Accl 2244 Cial-Ispit 23 Hindill 29 pBR322 4,361 bp Ball 2225 TthJ11- Part 2217 rop EcoRY 185 Bmtl-Nhel 229 Hamill 375 Sgr 400 Ball 471 Xml 2029 Pull 2064 Dalt 2162 BamB 2122 Banil 485 Bigl 128 Sphl 582 EcoN1 822 Sall-Accl-Hell 651 Pshu 712 BsaBl 1668 Engl 939 BeY1 945 Nrul 972 BAPT 1045 BspMI-BfuM 1063 PAMI 1315 Bumi 1353 Bgl 1650 BapEl 1664…
- Besides the pUC series, there are other plasmid vectors in the market such as pBR327 and pGEM-T. Some vectors are designed specifically for TA cloning while some are not. What is TA cloning? Explain in detail.Synthetic polylinker Hindill EcoRI sticky end 5 AATTCCTGCAGAAGCTTCCGGATCCCCGGG CITAA Plasmid cloning vector (cleaved with Eco) GGACGTCTTCGAAG GCC TAGGGG CCCTTAA AATTC Psti Hindi Nelson & Co, Leninger Principles of Biochemistryde ©2021 WH Freeman & Company BamHI Smal EcoRI sticky end Enzyme Polylinker transferase; 2 ligase; 6 lyase; 6 lyase; 4 ligase; 4 BamHi Smal CITAAG GRATT C EcoRI Which pairing correctly matches the enzyme class and Enzyme Commission number for the enzyme that catalyzes this reaction?Cloning vectors are not just limited to bacterial plasmids. Bacteriophages and M13 phage vectors are also commonly utilized in the cloning process. State any five (5) key criteria to be an effective cloning vector.
- Map of pUC18 is shown on the here. Describe how to select recombinant clones if a foreign DNA is inserted in to the polylinker site of pUC18 and then introduced into E. coli cells.. Hindll Sphl Sbfl Pstl BspMI Acci Hincli Sall Xbal BamHI Aval Smal Xmal Acc651 Kpnl Banll Eco53kl Sacl Apol ECORI lacz MCS LacR binding site Plac PUC18 Amp 2686 bps PMB1 oriBacterial plasmids often serve as cloning vectors. Describe the essential features of a plasmid vector.Competent E. coli cells were transformed with the pGLO plasmid. These transformed cells were then allowed to grow on two different plates: 1) a plate containing LB/AMP and 2) another plate containing LB/AMP/ARA. In which plate would you observe both phenotypic and genotypic changes? Briefly justify your answer. Edit View Insert Format Tools Table 12pt v Paragraph v BIUA e T?v 田 D2
- As a part of undergrad lab project, you have to clone Your Favorite Gene into plasmid cloning vector (4740 bp) pUC18. Restriction maps for both YFG and cloning vector are provided. The plasmid has a bacterial origin of replication (ori), an ampicillin resistance gene (AmpR) that degrades ampicillin antibiotic. It also has LacZ gene that encodes the β-gal enzyme, which converts white X-gal substrate into a blue product. pLac is a bacterial promoter. Restriction Enzyme Recognition Site : A slash (/) represents the cut site for each restriction enzyme. Enzyme 1 5’- G/TCGA C -3’ 3’- C AGCT/G-5’ Enzyme 2 5’-C/TCGA G-3’ 3’G AGCT/ C5’ Enzyme 3 5’- GTC / GAC- 3’ 3’- CAG / CTG- 5’ Enzyme 4 5’-C AATT /G-3’ 3’-G/ TTAA C-5’ Enzyme 5 5’C AATT/G-3’ 3’G/TTAA C-5’ Enzyme 6 5’G/GATC C-3’ 3’C CTAG/ G-5’ Enzyme 7 5’G/GATC C-3’ 3’C CTAG/ G-5’ 1a) The table below shows restriction enzyme pairs used by various teams to digest the YFG and clone it in the…Many resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical significance, because they can spread very easily through horizontal gene transfer. A culture of the bacterial isolate is grown, and plasmid DNA is isolated using a spin column-based solid phase extraction method. The purified plasmid DNA is then submitted for next-generation sequencing. Bioinformatic analyses of the sequencing results suggests that the following gene is likely involved in antibiotic resistance: > putative antibiotic resistance gene ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG…Besides PUC vectors, there are still other plasmid vectors in the market such as pBR327 and pZERO®-1. Some vectors are designed specifically for TA cloning while some are not. What is TA cloning? Explain in detail. Give two (2) examples of plasmid vectors that can undergo TA cloning. (i) (ii)