Activity 1: Ma One of program will n leamed on the program throug To the Filipin Truly yours, Your Name

Q: 33.  Which type(s) of proteins do(es) NOT interact with mediator

A: Introduction :- Transcription is the process of synthesis of different types of RNA molecules from…

Q: Synaptonemal complex mediates of homologous chromosomes. Replication O Pairing Segregation Crossover…

A: The correct option is pairing In eukaryotes, the synaptonemal complex (SC) is a protein structure…

Q: DRAWINGS (Don't forget to label the visible cellular parts.) Interphase stage Prophase Metaphase…

A: Mitosis is the called equatorial cell division, as both daughter cells have the same chromosome…

Q: Crossing over occurs during tetrad formation (synapsis) during prophase I.

A: Meiosis is a reductional division that leads to the formation of four genetically unidentical…

Q: n your point of view as a senior high school STEM student, are humans still volving? Provide…

A: Evolution means a change in the population. Evolution is the change in the characteristics of a…

Q: 7. What is the mais fenction ofa cell wa support and protect the cell to make and store DNA to…

A: The cell is the smallest structural and functional unit of life. It is commonly called the building…

Q: 5. Differentiate between the 3 types of cell cor sing an exampie. a. Paracrine b. Synaptic c.…

A: All of the cells in an organism's body must communicate with one another in order for it to function…

Q: 23. ID the region bracketing the letter 'A',

A: Question - 23 - ID the region bracketing the letter 'A'.

Q: Descrive in 2-3 sentences an in vitro experiment that differentiates between the Arp2/3 complex’…

A: The Arp2/3 complex is a core actin nucleator that binds to the sides of existing filaments to…

Q: Q) During M-phase of cell cycle, active M-Cdk phosphorylates several target proteins in order to…

A: In biology, the growth and development of an organism are maintained by the process of cell…

Q: ibin

A: Prescribing the medications for treatment is the primary function of a doctor which has expanded to…

Q: Myosin- A pröteln Compare the chromosomes and genes found in the red blood cells and the muscle…

A: GENES IN DIFFERENT BODY CELLS

Q: Summarize the role of the Xist gene in X inactivation inmammalian cells.

A: A DNA sequence encodes functional RNA, but that RNA is transcriptionally inactive; such a DNA…

Q: 13 – What is been unlock in this analogy?

A: Enzymes are biocatalyst that speed up the reaction. They are proteins.

Q: Insights with the stem cell 10 sentences.

A: Introduction: Stem cells are found in the very early stage of embryo and these are undifferentiated…

Q: Strength 22. You are analyzing a new human neuronal enhancer. You cloned the enhancer in front of a…

A: When a part is deleted, the expression is either same or decreased. And expression is same only when…

Q: . Synapsis occUis belween (a) mRNA and ribosomes (b) spindle fibres and centromere e) two homologous…

A: Meiosis is a reductional division. It is responsible for producing haploid gametes

Q: Sources of human stem cells: O inner cell mass of blastocyst umbilical cord blood O adult stem cells…

A: Stem cells are a reservoir of undifferentiated cells that can differentiate into any type of cell…

Q: why is it possible to easily collect cells by gently scraping the inside of your cheek?

A: Cells, which are the basic building blocks of all living species, are the basic building blocks of…

Q: nple of a gain-of-function experiment? pholinos to test the function of MyoD e-targeting to test the…

A: Gain of function means when the foreign DNA is inserted in anyone of the concerned cells, the gene…

Q: Synapsis and crossing over [Choose ] [Choose] Prophase II Telophase II Prophase I Telophase I…

A: Synapsis & crossing over - Prophase 1. Spindle form - Prophase 2. Chromosome decondensed -…

Q: Q H. Time Delelopmental potential MI

A: The developmental potential of a cell comparing to time is how was the cell at its initial stage…

Q: e important functions of apopt

A: Apoptosis is a common process through which programmed cell death takes place. There are two forms…

Q: metaphase G1 anaphase S interphase G2 prophase M Go telophase cytokinesis

A: A cell cycle is a series of events that takes place in a cell as it grows and divides.

Q: of the blanks and submit X, X' Complex IV of the ETC is reduced by and complex III is reduced by…

A: ETC (electron transport chain) is a chain of electron carriers, which is present in the inner…

Q: A DNA sequence looks like this:   GAA GAG GGG GCG   - Translate it to mRNA - Describe how you have…

A: The conversion of DNA to mRNA is known as translation.

Q: Describe the differences among embryonic, adult, and induced pluripotent stem cells.

A: Stem cells Stem cells are those cells that have the capacity of self renewal and differentiation.…

Q: URGENT Occasionally, a mouse X chromosome is broken into two pieces and each piece becomes attached…

A: Transcription is carried out by an enzyme known as RNA polymerase and a group of proteins known as…

Q: Learning Task 6: Matching Type : Match column A with column BColumn A 1. translocation Column B a. a…

A: Translocation : ( c) A piece of chromosome breaks off and attaches to another chromosomes.…

Q: а. G1 b. S С. G2 2. Prophase 3. Metaphase 1. Anaphase Telophase

A: The Interphase, Prophase, Metaphase, Anaphase, and Telophase are the stages that occur in the cell…

Q: CYTOGENESI HISTOGENESI GROWTH AND ANGIOGENESI S S DIFFERENTIATIO S ZRD MONTH 4TH MONTH 5TH MONTH 6TH…

A: The development from embryo to fetus is a biomedical marvel. A single cell slowly develops into a…

Q: Sto G. Checkpoint Is my DNA copy corect? Am I ready to divide? Prophase Metaphase M Checkpoint Are…

A: Mitosis is the division of a single cell into two daughter cells that are identical (cell division).…

Q: ms/d/e/1FAlpatseg The secretes a hormone that increases the body's metabolic rate, promotes…

A: Nodes of ranvier are specialised regions in axon. They are not insulated by myelin.

Q: 5. For M-Cdk to be activated, inhibitory and activating phosphorylate the mitotic CDK, whilst an…

A: Enzymes and proteins play an important role in the regulation of a cell's life cycle. Until M-cyclin…

Q: 7.Chromosomes are found in the 8.Genes are pieces of DNA located on the of a cell. ----- .--

A: 7. Chromosomes are found in the nucleus of a cell.   8. Genes are piece of DNA located on the…

Q: Describe why PARP inhibitors are considered targeted therapies (affecting only cancer cells and not…

A: A cancer cell is a cell that is dysfunctional that does not obey  cycle. Cancer cells, rather than…

Q: Compare and contrast GPCRs with RTK. Please keep brief - 10 sentences/dot points max.

A: The difference between GPCR and RTK are:   G-protein coupled Receptors Receptor Tyrosine Kinases…

Q: Prophase Metaphase Anaphase Telophase 00 G Interphase B Act

A:

Q: Apoptosome activates what initiator caspase?

A: Programmed cell death is known as apoptosis. It occurs in multicellular organisms. Apoptosis results…

Q: 5--ATTGAGGATСССТААТGTGTССTGATCACGCTССАТА-3 3'ТААСТССТАGGCATTACACAGGACTAGTGCGAGGTAT -5'

A: BamH1 is Restriction endonuclease enzyme which cleaves at specific sequence and produce sticky ends…

Q: What are the significance of APOPTOSIS. State whether it is a normal developmental phenomena or not,…

A: Apoptosis is programmed cell death. It is used in the development early stages to remove unwanted…

Q: During M phase, how M-Cdk can trigger cohesin dissociation as well as Mad2 triggers mitotic…

A: The cyclin dependent kinases act as molecular switches that regulate the various events during the…

Q: g processes produce/s daughter cells that are genetically identical to the original parent cell? (a

A: Answer:

Q: diagram shown represents the coding strand of the myosin gene. in myosin lead to muscie delects…

A: The correct answer is Option E - LANE 5 Explanation The regulatory region of a gene is a sequence of…

Q: cell determination is the expression of the cell's specialized role true or false

A: The commitment of cells to specific cell fate and their capacity to differentiate into particular…

Hematology

Hematology is the branch of biology. Hematology is the medical field that deals with the treatment of blood disorders and cancers, such as hemophilia, leukemia, lymphoma, and sickle-cell anemia. Hematologists and hematopathologists are medical professionals who specialize in illnesses of the blood and its components.