3. Write a program that prompts the user for a file name, assuming that the file contains a Java program. Your program should read the file and print its contents properly indented. When you see a left-brace character ({) in the file, increase your indentation level by four spaces. When you see a right-brace character (} ), decrease your indentation level by four spaces. You may assume that the file has only one opening or closing brace per line, that every block statement (such as if or for) uses braces rather than omitting them, and that every relevant occurrence of a ( or } character in the file occurs at the end of a line. Consider using a class constant for the number of spaces to indent (4), so that it can easily be changed later.

3. Write a program that prompts the user for a file name, assuming that the file contains a Java program. Your program should read the file and print its contents properly indented. When you see a left-brace character ({) in the file, increase your indentation level by four spaces. When you see a right-brace character (} ), decrease your indentation level by four spaces. You may assume that the file has only one opening or closing brace per line, that every block statement (such as if or for) uses braces rather than omitting them, and that every relevant occurrence of a ( or } character in the file occurs at the end of a line. Consider using a class constant for the number of spaces to indent (4), so that it can easily be changed later.

EBK JAVA PROGRAMMING

9th Edition

ISBN:9781337671385

Author:FARRELL

Publisher:FARRELL

Chapter7: Characters, Strings, And The Stringbuilder

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

Can i get help writing this program in c++ on microsoft visual 19 with this input file incorporated. The client should read in the file contents and store them in the object. The file will be formatted such that the first line contains the month name, the second line contains the year, and each successive line contains a temperature. A typical input file might contain: June 2019 90 85 97 91 87 86 88 82 83 85
OBJECT ORIENTED PROGRAMMING LESSON LABORATORY EXERCISE-1 Problem: Write a program that takes position and current salary value from the user and calculate the new salary and shows it on the console according to the following table. Position Manager Salesman Human Resources Technician Headman Example: Enter your position: Manager Enter your current salary: 10000 New salary: 11000 Raise Percentage %10 %20 %15 %25 %23 Write your program using Java and copy your codes to a text file which has your name and surname. Then load it into UZEM under the provided link.
Problem Definition Task. Your task is to develop a python program that reads input from text file and finds if the alphanumeric sequence in each line of the provided input file is valid for Omani car license plate. The rules for valid sequences for car plates in Oman are as follows: Each sequence is composed of 1 to 5 digits followed by one or two letters. Digits cannot start with 0, for instance, 00, 011, or 09 are not valid digit sequences. The following list are the only valid letter combinations: ['A','AA','AB','AD','AR','AM','AW",'AY"', 'B', BA','BB','BD',"BR','BM',"BW',"BY', 'D','DA','DD','DR','DW','DY', 'R','RA','RR','RM','RW','RY', 'S','SS', 'M','MA','MB','MM','MW','MY", "W',"WA',WB',"wW', Y,YA','YB','YD','YR','YW',YY] Program Input/Output. Your program should read input from a file named plates.txt and write lines with valid sequences to a file named valid.txt. Any line from the input file containing invalid sequence should be written to a file named invalid.txt. Each line…
The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcompositionUse python
8.In this exercise you will create a program that will be used in a digital library to format and sort journal entries based on the authors last name. Each entry has room to store only the last name of the author. Begin by removing the first name "Isaac" from the string variable journal_entry_1 by using the string function erase. Do not forget to also remove the whitespace so that the string variable journal_entry_1 will then contain the string "Newton" with no whitespaces. The journal entries should be sorted alphabetically based on the authors last name. For example, the last name "Brown" should come before the last name "Davis" Create an if statement so that if the last name contained within journal_entry_2 is alphabetically less than the last name contained within journal_entry_1, then the string values are swapped using the string function swap. You may use either of the comparison operators < > in the if statement but remember that following ASCII, "A" is lexicographically…
The file "dna.seq" (on Blackboard) consists of several DNA sequences. Write a program that reads in the file "dna.seq” and counts the number of sequences with the following properties: • The total number of sequences in the file • The number of sequences that have the pattern CTATA • The number of sequences that have more than 1000 bases • The number of sequences that have over 50% GC composition • The number of sequences that have more than 2000 bases and more than 50% GC composition Some program requirements: (1) the program should prompt the user for the filename. (2) each of the above tasks should be its own function. dna seg file = CAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTATACCGCGAAACTGCGAATGGOTCATTAAATCACT TATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGOTAATACATGOTAAAAAGO CCGACTCACGGAGGGTTGTATTTATTAGATTAAAAA
The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcomposition
String data type is not allowed you can make use of CString instead (char arrays with null termination). Write a menu driven C++ program to perform the following four tasks in a single file, if user press option 1 the task 1 get solved and so on: 1. Display the Item_Id of the products which are not available in stock on screen. 2. Copy all the available products data in a separate file. 3. Read the original input file and update the price of each item by 10 percent increase in the original price and save the complete information in separate file. 4. Try to save the information processed in part 3 in the original file by updating it instead of using separate file.
9.Code please. In this exercise you will create a program that will be used in a digital library to format and sort journal entries based on the authors last name. Each entry has room to store only the last name of the author. Begin by removing the first name "Isaac" from the string variable journal_entry_1 by using the string function erase. Do not forget to also remove the whitespace so that the string variable journal_entry_1 will then contain the string "Newton" with no whitespaces. The journal entries should be sorted alphabetically based on the authors last name. For example, the last name "Brown" should come before the last name "Davis" Create an if statement so that if the last name contained within journal_entry_2 is alphabetically less than the last name contained within journal_entry_1, then the string values are swapped using the string function swap. You may use either of the comparison operators < > in the if statement but remember that following ASCII, "A" is…
Computer Science In C++ can someone make a code where it reads a txt file and displays the text file that has pending shipping orders. I would also like the code to be able to modify the text file in terms of canceling shipping orders or view shipping orders.
Python please: Given a text file named RandomTextFile.txt that contains newline characters, write a program that removes all the newline characters from the file. Your program should use the filename as input, and the output file should use the same filename as the original. Use the attached file RandomTextFile.txt to help you write and test your program. It contains the following text: Python is an interpreted language and the python interpreter is a computer program that executes code written in the python programming language. The python interactive interpreter is useful for simple operations or programs consisting of only a few lines. For more lines, a programmer can write Python code in a file, and then provide that file to the interpreter. For normal development a programmer installs python as an application on a local computer. Macintosh and Linux operating systems usually include python, while Windows does not. Programmers can download the latest version of python for free from…
Task: Loading data from files This exercise will require you to load some information from files and use it in your program. scene.txt contains a description of a series of shapes and colours to draw. You need to write code to read in the file data and draw the requested shapes in the correct colour. Each line in scene.txt will contain one of the following starting keywords followed by some data:  COLOUR followed by 3 values: R, G, B  CIRCLE followed by 3 values: X, Y, RADIUS  RECT Followed by 4 values: X, Y, W, H  LINE Followed by 4 values: X1, Y1, X2, Y2 CIRCLES are defined from the center. RECT's are defined from the top left. All values are space separated, and you can assume all input is correct (no errors). Please solve this program to draw the scene. I can't upload the file scene.txt, so I decide to screenshot a file for you. Subject: Java Programming