2. Name the first complementary base from the 3' direction. Type your answer in ALL CAPITAL LETTERS.D OCH,-OCH 1. How many 3',5'-Phosphodiester linkages were formed from the complex of the given structure? Type the NUMBER ONLYO OCHs

DNA act as genetic material in most of the organisms. DNA is composed of nitrogenous bases,…

Answered: 2. Name the first complementary base…

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter3: Biological Macromolecules

Section: Chapter Questions

Problem 16RQ: The helix and the pleated sheet are part of which protein structure? primary secondary tertiary...

See similar textbooks

Similar questions

1. Which of the following is true about phosphodiester linkage? a) 3'-phosphate group of one nucleotide unit is joined to the 5'-hydroxyl group of the next nucleotide b) 3'-phosphate group of one nucleotide unit is joined to the 3'-hydroxyl group of the next nucleotide c) 5'-phosphate group of one nucleotide unit is joined to the 3'-hydroxyl group of the next nucleotide d) 5'-phosphate group of one nucleotide unit is joined to the 5'-hydroxyl group of the next nucleotide
Show below is a polypeptide comprised of 3 α-helices and 5 β-sheets joined by randomcoil. Characterizetheforces that stabilize the tertiarystructure and draw the interacting side chains ofd) Cys Cys
Draw the dinucleotide AT and label the following: 5’ and 3’ ends Phosphodiester bond N-glycosidic bonds
1. What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. 2. Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro-
I. II. III. IV. V. O HƠN-CH-CANH-CH-C-NH-CH-CO alanyl CH3 2. Types of protein structures: What is the type of protein structure that contains a single strand and bound by disulfide bond. glycyl OH serine The structure containing an alpha- helix CH, 0 || H₂N-C-C-OH H O The structure contains beta pleated sheets The structure is made up of subunit What is the difference between a tertiary structure and a quaternary structure? CH₂OH 3. Indicate which structure is at low pH (acidic, basic or neutral (zwitterion) protein structures? H R H₂N-C-COO™ 4. What are five factors that affects 5.Indicate the amino acid as polar or nonpolar OH CH, O ! H₂N-C-C-OH H CH: 0 H₂N-C-C-0 H CH3 CH3 CH CH, O H₂N-C-C-0 H 6) Acids and bases denature a protein by disrupting A) peptide bonds and ionic bonds. B) amide bonds and alkene bonds. C) hydrophobic interactions and peptide bonds. D) ionic bonds and hydrophobic interactions. E) ionic bonds and hydrogen bonds. 5) Heat denatures a protein by disrupting A)…
Match the following nucleobases (designated AD) with their names and answer questions about them. NH, NH, C D NH2 Note that some of the items from the answer list should NOT be used. Guanine 1. Aand B - Cytosine 2 Cand D • Adenine 3. Not shuwn v Thymine 4. D v Uracil 5. B a Aand C v Which of tho shown bases are pyrimidines? 7. A and O v Which of the shown bases form canonical A-T Watson-Crick base pair? S. A v Which of the shown bases form canonical G-C Watson.Crick base-pair? 9. Band C 10. C 11. Band D
Draw the structure of the following nucleotide: adenosine 3'-monophosphate or guanosine 2-monophosphate
Which of the following is true of the molecule below? nucleotide 5' 3′ H₂C H₂C TNHNA O. HN CNH…NG NH O NH O HNU NH O CNHNG OHN nucleoside CH₂ CH₂ a purine pairs with a pyrimidine base the bases are held together by covalent bonds a nucleoside is made of the same components as a nucleotide The bases make up the backbone on the sides of the molecule
9. Identify the structures in the following pictures of various features in the structure of HEWL: Cys sig Cys B 10. What is the handedness of the helix in 9C, above? 11. Approximate the phi,psi values for the central elements of 9C and D.
(a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 21
Given the structures of the ribonucleotides and deoxyribonucleotides: Adenine Uracil Thymine HN Adenine NH HO-P-0- CH2 HO-P-0 CH2 HO-P-0-CH2 HO-P-0-CH он он он он OH H OH H Cytosine Cytosine Guanine Guanine NH2 NH NH2 CH2 HOo CH2 HO-P-0 -CH2 он он он он OH H OH H • Draw the structure of the polyribonucleotide UAGCCUG. Draw the structure of the polydeoxyribonucleotide CGTAGAT.
3. Supra-secondary structures of proteins - supercoiled alpha- helix, Greek key, meander, interlock, roll, beta-hairpin. Draw (schematically) these structures.

SEE MORE QUESTIONS

Recommended textbooks for you

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781305073951

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781305073951

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS

2. Name the first complementary base from the 3' direction. Type your answer in ALL CAPITAL LETTERS. D oCH, -OCH -OCH