Q: Direction: Read and analyze the following laboratory experiment and answer the following question.…
A: By studying cells in the laboratory, scientists can better understand the underlying processes that…
Q: Extracellular recordings create a distinct action potential. Choose the option that best describes…
A: Action potential is a kind of impulse that arises due to the stimulation of the neuron. It consists…
Q: In this diagram, which of the following is TRUE? H+ (proton) Organic molecule that includes two…
A: Option B ) The NAD+ becomes reduced.
Q: Using the trait in the previous question, identify the genotype and phenotype ratios from a cross…
A: Incomplete dominance dhffers with complete dominance in a way that in incomplete dominance the…
Q: 1. On your ovulation chart, mark the unfertile, likely to be fertile, and the most fertile days. Put…
A: Menstrual liquid comprises blood, endometrial cells (uterine lining cells), and mucus. Menstruation…
Q: 4. 0,5 liters of isotonic glucose solution was infused into experimental animal. As a result of it…
A: Erythrocites/ red blood cells: The most prevalent form of blood cell and the main source of oxygen…
Q: In moose, brown coat color (B) is dominant to albino (no pigment) (b) and rough coat (R) is dominant…
A: In genetics, dominant and recessive refer to the relationship between two versions of a gene, called…
Q: Considering the pandemic brought about by COVID-19, there has been plant-based products/ herbal…
A: Nowadays we are very familiar with the deadly virus Covid-19.It form pandemic in 2019-2021.This…
Q: list any three parasites adaptations in plants
A: Introduction: parasitic plant is one that derives all or a portion of its nutrients from another…
Q: With an example, explain how a change in an amino acid can change the structure of a protein.
A: The amino acid sequence of the protein is responsible for generating its 3D structure. A mutation in…
Q: How many atoms make up one carbon dioxide (CO2) molecule? How many different types of atoms are…
A: Biomolecules are the macromolecules required by biological cells for their survival growth, and…
Q: T = Tall t = short pollen from a tall pea plant T T eggs from a tall pea plant T TT TT t Tt Tt In…
A: ANSWER) In the given cross the Tall plant with genotype TT is crossed with the short plant of…
Q: QUESTION 2 Which of the following statements about hominins is FALSE? Each hominin species on Earth…
A: Hominin are the group that includes modern humans as well as extinct human species and all our…
Q: Independent of any possible effects of parasites, estimate the reduction in frog density caused by…
A: Let no trout, no parasite as pond 1 no trout, parasite as pond 2 trout, no parasite as pond 3…
Q: E. O. Wilson states that conservation must be made "profitable". What does this mean?
A: The study of the loss of earth's biological diversity and its prevention is called conservation. The…
Q: The table shows the distribution of traits (A-E) in six extant species (1-6). A “0” indicates the…
A: Evolutionary biology deals with the evolutionary aspects of organisms. Systematics refers to the…
Q: Choose the false statement regarding the scientific method. The scientific method is used to test…
A: The false statement is: The scientific method is used to test hypothesis and observations.
Q: List 4 factors that increase O2 extraction to the tissues (muscles).
A: Exercise hyperemia is the term used to describe the increase in blood flow to the skeletal muscles…
Q: An experiment was conducted looking at the likelihood to get covid when you are not vaccinated,…
A: The independent variable is the variable that is changed or manipulated by the researcher.
Q: Which of the following molecules is more likely to diffuse through a synthetic lipid bilayer (i.e. a…
A: Part A. The protein backbone is the repetitive structure with nitrogen, alpha-carbon and carbon…
Q: Part III-PGD? Suzanne and David decided to have children. They wanted to ensure that their children…
A: NOTE: according to the answering guidelines, I am going to answer only first question. Please post…
Q: Which of the following molecules is more likely to diffuse through a synthetic lipid bilayer (i.e. a…
A: Being completely made of lipids and containing no transporters, the lipid bilayer will be highly…
Q: MODEL 1: 1. His 119 6. His 119 CH O-P-O- 01 HCHO HCH Substrate O-P-O OH +H₂N OOH CH H₂N. His 12 $…
A: Enzymes are the proteins synthesized in the cell by the process of translation from mRNA. The…
Q: define biomonitoring.
A: Biomonitoring is a process of monitoring the health and/or environmental quality of an environment…
Q: Label this drawing of a plant cell
A: Plant cells are defined as the eukaryotic cells which differ from those of other eukaryotic species…
Q: In rabbits, long fur (L) is dominant over short fur (1). There is also a gene that causes spots on…
A: It is a dihybrid cross, here it is provided that in rabbits, coat length and coat color are…
Q: how many nucleotides are in CAGATTGTGAAGAGGTCTCTTGA consensus coding sequence? Answer in numerical…
A: Nucleotides are organic molecules made up of a phosphate and a nucleoside. They function as…
Q: What are the immunosensors used in the medical field? What are some examples of immunosensors? What…
A: Immunosensor are actually biosensor which is established on the theory of immune system where an…
Q: In the Gram stain, gram-positive bacteria are dark purple for all the following reasons EXCEPT: None…
A: Introduction : The bacteria are classified on the basis of staining as gram-positive and…
Q: This scientist provided evidence that spontaneous generation does not occur by showing that the…
A: In 1668, the theory of spontaneous generation became widely accepted. It implied that life evolved…
Q: how many amino acids are in CAGATTGTGAAGAGGTCTCTTGA peptide sequence? Answer in numerical digits…
A: The DNA acts as the genetic element in most organisms. The genes are transcribed in mRNA. mRNA so…
Q: how does genetic engineering help us grow oranges?
A: Genetic engineering is a biological process in which transgenic or genetic modified individuals are…
Q: Select the choice that identifies the organism described in the following statement: The organism is…
A: There are different types of organisms present on earth. Some types are- Prokaryotes- these…
Q: Which of the following is false about open circulatory systems? Question 5 options: a)…
A: Introduction A circulatory system is a transport system through which nutrients, gases, and other…
Q: A child weighing 28 pounds is to receive acetaminophen for fever and pain. The recommendations for…
A: Given that weight of the child is 28 pounds. Therefore, weight in kg's = 28 × 0.454 = 12.7 (Because…
Q: 1. (a) In diploid organisms, haploid cells or gametes are produced by meiosis. Fig. 2.1 shows…
A: Introduction:- Meiosis is the process in which a single cell divides twice to form four haploid…
Q: Suppose that researchers wanted to examine the combined effects of an introduced predator (a trout)…
A: The effect of the parasites and the introduced species on the native species is observed in the…
Q: Part 1: Briefly describe the levels of organisation within the Human body. You should start your…
A: Organizational levels are natural structures that are typically described by part-to-whole…
Q: give inherent constraints associated with the biology of the of zebra fish and quail or chicken eggs…
A: Developmental biology is the study of the process by which organisms grow and develop, beginning…
Q: 2 Please draw the arrow-pushing mechanism to create the polyketide backbone chain of TYLOSIN. If two…
A: The arrow-pushing mechanism is a type of drawing or method in which the arrow moves from the…
Q: Stains are used because O they bind evenly to all str they reduce contrast and make it easier to see…
A: Staining is a procedure in microscopy where a specimen to be viewed under the microscope is…
Q: Compare and contrast the methods used by bacteria and protozoa to stay alive even when conditions…
A: Microorganisms are tiny entities that cannot be seen as such through naked eyes but require…
Q: How can you distinguish growth from development?
A: Life starts with a single cell and becomes a complex organism during the course of growth and…
Q: All of the following are correctly matched and can be found in bacteria EXCEPT: Cell wall - contains…
A: Bacteria are microscopic, single-celled organisms that can be found in virtually any environment,…
Q: Which of the following is NOT true of ionic bonds? They are formed because of the mutual attraction…
A: Ionic bond is also known as electrovalent bond. It is the complete transfer of valence electrons…
Q: If the ocular lens is 10x, what would be the total magnification for the following objectives…
A: A microscope consists of two types of lenses, the low power lens is called the ocular lens also…
Q: RUFF! MY EARS ARE DOMINANT! Dihybrid Crosses - Problem 2 THIS ONE ISN'T REAL (DOG EARS / COLORING…
A: In problem it was given that allele for floppy ears is dominant to pointed ears. floppy ears…
Q: Macromolecule Carbohydrates Lipids Proteins Nucleic Acids Monomer Amino Acids Elements Present C,H,O…
A: Large, naturally occurring cellular components known as biological macromolecules perform a number…
Q: Which chemical class of hormones are synthesized from cholesterol, and are entirely constituted by…
A: The chemical that coordinate different types of functions in our body and carry messages through our…
Q: Describe the path and all related steps that a molecule of oxygen would take from the air in the…
A: First of all we know that respiration is a very essential process for our body.Only throgh this…
Pls help ASAP.
Step by step
Solved in 2 steps with 1 images
- Plants containing only chlorophyll b are exposed to radiation with the following wavelengths: 10nm (x- rays), 450nm (blue light), 670nm (red light), and 800nm (infrared light). Which plants harness the most energy for photosynthesis? X-ray irradiated plants Blue light irradiated plants Red light irradiated plants Infrared irradiated plantsWhich of the following is a correct step in the light-dependent reactions of the Z system? a. Light is absorbed at P700, and electrons flow through a pathway to NADP+, the final acceptor of the linear pathway. b. Electrons flow from photosystem II to water. c. NADP+ is oxidized to NADPH as it accepts electrons. d. Water is degraded to activate P680. e. Electrons pass through a thylakoid membrane to create energy to pump H+ through the cytochrome complex.Describe the flow of electrons through photosystems I and II in the noncyclic electron transport pathway and the products produced. Contrast this flow with cyclic electron transport.
- Which of the following substances does not participate in the CalvinBenson cycle? a. ATP b. NADPH c. RuBP d. PGAL e. O2 f. CO2The Overall Free Energy Change for Photosynthetic NADP+ Reduction What is the overall free energy change (G) for noncyclic photosynthetic electron transport? 4 (700-nm photons) + 4 (680-nm photons) + 2 H2O + 2 NADP+O2 + 2 NADPH + 2H+Which of the following statements about the C4 cycle is incorrect? a. CO2 initially combines with PEP. b. PEP carboxylase catalyzes a reaction to produce oxaloacetate. c. Oxaloacetate transfers electrons from NADPH and is reduced to malate. d. Less ATP is used to run the C4 cycle than the C3 cycle. e. The cycle runs when O2 concentration is high.
- As you learned in this chapter, cell membranes arc required for electron transfer phosphorylation. Thylakoid membranes in chloroplasts serve this purpose in photosynthetic eukaryotes. Prokaryotic cells do not have this organelle, but many are photosynthesizers. How do you think they carry out the light-dependent reactions, given that they have no chloroplasts?In photolysis some of the energy captured by chlorophyll is used to split (a) CO2 (b) ATP (c) NADPH (d) H2O (e) both b and cDlagram 4: The Light Reactions of Photosynthesis STROMA ow soncedration Oytnho e mples Photoeystem B Photoeystan I NADP Light OPM THYLAKOID SPACE gh r cenentration Cavin Cyele Thylakoid membrane ATP STROMA dow H ooncentration) ythse ADP Diagram 4 shows a single thylakoid membrane taken from a chloroplast inside of a leaf cell. The events of the light dependent cydle that take place along the thylakoid membrane are shown. ight energy is captured by ATP synthase O Photosystems I and II D NADP+ reductase O The thylakoid membrane's lipid structures
- Diagram 4: The Light Reactions of Photosynthesis STROMA dow concentralion Photonystem B Cytch e Photosystem Light omplex Light NADP reductoe NADP NADPH THYLAKOID SPACE igh ooncentration) Cavin Cyle Thylakid menbrane ATP STROMA ow H eone sythase ADP ATP Diagram 4 shows a single thylakoid membrane taken from a chloroplast inside of a leaf cell. The events of the light dependent cycle that take place along the thylakoid membrane are shown. Light energy is captured by O ATP synthase O Photosystems I and II O NADP+ reductase The thylakoid membrane's lipid structures DroviousDiagram 4: The Light Reactions of Photosymtnes STROMA dow soncentrations Photoeystem PhotoeytmE oomple Light Ligt THYLAKOID SPACE Ohigh concentration) Thylakold membrane ATP wynthase STROMA low H concentration) ADP en from a chloroplast inside of a le the light dependent cyde that take place along the thylakoid membrane a Diagram 4 shows a single thylakoid membrane In photosystem I and II, an electron will O be transferred to ATP be transferred to NADPH lose energy gain energyDiagram 41 The Light Reactions of Photosynthesis STROMA Poteyte Potayate mples HAD Light HLARO ACE (high ir Carto Thylakold membrane ATP ynthase STROMA ow N concentration) ADP Diagram 4 shows a single thylakoid membrane taken from a chloroplast inside of a leaf cell. The events of the light dependent cycle that take place along the thylakoid membrane are shown. Identify an energy transfer that takes place n Diagram 4. Light energy is directly transferred into the chemical bonds of sugar. O Light energy is directly transferred into the chemical bonds of ATP The energy of the bonds of water are transferred into the chemical bonds of ATP. The energy from an excited electron is transferred into the chemical bonds of NADPH.