15. Transamination reactions involve the conversion of a-ketoglutarate to (or from) which of the following molecules?
Q: How do ADP and ATP regulate the glycolysis pathway?
A: Glycolysis is an important metabolic pathway which participates in the carbohydrate metabolism. This…
Q: Movement of water is controlled by which factor?
A: Movement of water occurs through the xylem cells of plants to reach all parts of plant body . As…
Q: 2. Reaction Mechanism and Molecularity Step 1 (slow): O3+ NO2 NO3 + O2 Step 2 (fast): NO, + NO: NO…
A: Molecularity is defined as the total number of molecules that participate in the reaction…
Q: Draw and explain how SMC1 and SMC3 proteins form a heterodimer.
A: SMC1 and SMC3 proteins are involved in the formation of a heterodimer complex during the process of…
Q: Neutrophils exhibit a respiratory burst of free radicals and strong oxidizers during acute…
A: Free radicals are highly energetic chemical species that go onto react with almost anything.…
Q: 14. Paracrine signaling is characterized by ligands that are A. produced by the target cells…
A: Paracrine signaling is a type of cell signaling in which the signals are released into the…
Q: E A C F В H O2 G Fumarate
A: The electron transport chain is a process in which the NADH and [FADH2] that is produced during…
Q: 2. (a) Both myoglobin and haemoglobin bind oxygen. If muscle did not contain myoglobin, what would…
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…
Q: Choose which statement describes an anabolic (synthesis) reaction. Select all that apply. A molecule…
A: An anabolic process involves the process of synthesis of complex cellular macromolecules from…
Q: c. On the mature mRNA transcript in eukaryotes, start codon is not found at the beginning of the 5'…
A: Mature mRNA transcripts in eukaryotes are those eukaryotic RNA transcripts that have been spliced…
Q: pls solve this problem with in 15 to 30 min
A: 1 Hemiacetal in general , when aldehyde can react with alcohol forms hemiacetal. The linear…
Q: Long explanations are not needed. Direct answers may suffice. a. B-D-2-Deoxyribose is an…
A: Glucose and the five carbon sugars can cyclize through intramolecular nucleophilic attack of one of…
Q: Velocity (mM/min) [S], mM Uninhibited Inhibited 1.75 1.94 1.38 2.17 2.26 1.67 3.00 2.85 2.13 5.50…
A: Enzyme kinetics are studied using Michaelis Menten equation. This equation is as below: V = VmaxSKM…
Q: Which compound is NOT a membrane lipid? a). Sphingolipid b). Glycerophospholipid c).…
A: A plasma membrane is composed of a lipid bilayer that allows the diffusion of non-polar molecules…
Q: Why is the 3-Dimensional structure important for protein function?
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Long explanations are not needed. Direct answers would suffice. a. Flux through the pentose…
A: The Pentose phosphate pathway is a metabolic pathway that occurs parallel to glycolysis in the…
Q: 4. The diagram below illustrates time dependent O₂ uptake by isolated skeletal muscle mito- chondria…
A: The mitochondrial respiration process involves the activation of the electron transport chain. The…
Q: What are the three major pathways that eventually become entry points of molecules into the Krebs…
A: In the Krebs cycle, acetic acid or its equivalent provides energy to the organism through oxidation,…
Q: In the absence of oxygen, what would happen to a cell that performs aerobic cellular respiration? O…
A: There are two type of cellular respiration.One is aerobic cellular respiration and other is…
Q: Which of the following statements about protein digestion are true? Check all that apply. ► View…
A: Proteins are macronutrients, which act as the building blocks of the body. Proteins can also act as…
Q: Phosphorylases and phosphatases catalyze the same reaction, the removal of a phosphate group. O True…
A: Enzymes are proteins that bind to substrate molecules and stabilise the transition state, lowering…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: What are Okazaki fragments? Why are they formed?
A: DNA replication is the process by which double-stranded DNA is copied to produce two identical…
Q: Long explanations are not needed. Direct answers would suffice. a. Lactose, a disaccharide…
A: Disaccharides have two monosaccharide units joined by a glycosidic bond. They are of two types.…
Q: How is the chemiosmotic potential generated?
A: Chemiosmosis is the movement of ions across a selectively permeable membrane.
Q: 6. H₂C HO Which of the following dinucleotides can be methylated by DNA methyltransferase? NH₂ NH₂ 9…
A: Since you have asked multiple questions, we will answer only first question for you. In order to get…
Q: HN Histidine NH₂ OH HN + H |+ H-NH H
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Shown in the figure, is a portion of the electron transport chain pathway, in which electrons are…
A: The electron transport chain is the transfer of electrons through a series of electrons carriers to…
Q: Which of the following is true of guanine? Select all that apply. a Guanine has a one-ring…
A: Purine : Have double ring structure Pyrimidine: Have single ring structure
Q: 3. Give the specific enzyme class and first two digits of the enzyme's EC number for each…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: uconcogenesls
A: Glycolysis is a Greek word which means sweet and lysis or the lysis of sweet. the other name of the…
Q: protein analysis, where protein particles go
A: Introduction: Proteins, also known as polypeptides, are organic compounds made up of amino acids.…
Q: Which would be faster to metabolize starch glucose galactose
A: Metabolism is a set of chemical reactions through which what we consume through food through diet…
Q: a. Transketolases catalyze two-carbon fragment transfer from sedoheptulose-7-phosphate to…
A: "Since you have posted multiple questions we will answer the first question for question. If you…
Q: A polypeptide contains 36 amino acids. How many nucleotides should be found in the open reading…
A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA that codes for a specific…
Q: Which of the following is not a complex conjugated carbohydrate? O peptidoglycan O glycoprotein O…
A: Sugar molecules are carbohydrate molecules. Carbohydrates are one of three main nutrients found in…
Q: antibiotic
A: Antibiotics, also known as antibacterials, are medications that destroy or slow down the growth of…
Q: How many calories of energy/osmole would need to be expended in order to concentrate a solute…
A: Solute = 75 fold Generating a gradient 75 times as much solute on the one side of membrane than the…
Q: In the spectrophotometer, why is there a need to measure a 'blank' sample? What will happen to the…
A: A spectrophotometer is one of the most frequent tools used by scientists to determine the presence…
Q: Using four examples, describe the relationship between enzyme characteristics and the choice of…
A: Enzyme immobilization is confinement of enzyme to a phase one of a kind from the only for substrates…
Q: 1. (a) The reaction catalyzed by citrate synthase is the first step of the TCA cycle. In glycolysis,…
A: The highly exergonic (energy releasing) reaction catalyzed by citrate synthase is given below
Q: Identify which of the following amino acid residues can have hydrogen bonding between their side…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: ACTIVITY 6.1 Complete the table below Source Example of Carbohydrate Function
A: Carbohydrates are a form of macronutrient that can be found in a variety of foods and drinks.…
Q: During a 20-minute workout, a person burns 350 calories. What is the number of grams of glucose…
A: In-order to solve this problem, first we to find the amount of ATP generated in the given muscle…
Q: disease. As such, a frontline treatment for Type 2 diabetes is the drug metformin, which acts…
A: Hi! Thanks for your question. As you have posted multiple questions, we are answering the first…
Q: Which of the following statements are correct according to the article? Select one or more: O…
A: Introduction: Acetaminophen is a synthetic non-opiate derivative of p-aminophenol that is given…
Q: In the RBCs of the patient described above, which ONE of the following listed below would be…
A: Pyruvate kinase deficiency is an inherited lack of the enzyme pyruvate kinase, which is used by red…
Q: Polysaccharide Chondroitin Heparin Hyaluronate Dermatan Sulfate Keratan Sulfate Mucin Unique Feature…
A: A polysaccharide is a large molecule composed of numerous smaller monosaccharides. Monosaccharides,…
Q: Compare and contrast proteoglycans, glycoproteins, and glycosaminoglycans. Cite examples for each
A: Glycobiology means the study of the structure, and function of carbohydrates attached to…
Q: Propionic acid with a pk of 4.88 is a weak acid. Which situation is likely to occur in a propionic…
A: Introduction: The ionization constant (pKa) is a value that tells us the tendency of compounds or…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- 1. Select the INCORRECT statement about Glutamate dehydrogenase : a. Catalyzes the removal of NH4+ into glutamate b.Catalyzes the incorporation of NH*4 into a-ketoglutarate c. Catalyzes the removal of NH*4 from glutamate C d. Catalyzes the incorporation of NH'4 into a-keto acid1. Discuss why a saturated fatty acid like lauric acid has a good anti-oxidant property. 2. Why are the essential fatty acid associated with low incidence of heart disease? Cite some clinical signs of essential fatty acid deficiency. 3. Explain how aspirin can block the synthesis of prostaglandins?In this transamination reaction (right), which of the following are the products X and Y? Oxaloacetate Glutamate A Alanine, a-ketoglutarate B Aspartate, a-ketoglutarate C Glutamate, alanine D Pyruvate, aspartate
- 1. Explain the reaction mechanism involved how glucogenic amino acids can yield either a pyruvic acid or an oxaloacetic acid. In what pathway will pyruvic or oxaloacetic acid be used and why is this pathway important? 2. Discuss the reaction mechanism involved how the -NH2 groups of amino acids are being metabolized. 3. Explain why gluconeogenesis under conditions of starvation or diabetes breaks down body proteins. Complete answer please. Thank you. |26. These catalyze oxidation and reduction reactions, e.g. pyruvate dehydrogenase, catalysing the oxidation of pyruvate to acetyl coenzyme A. a. oxidoreductases b. transferases c. hydrolases d. ligases 27. These catalyze transferring of the chemical group from one to another compound. An example is a transaminase, which transfers an amino group from one molecule to another. a. oxidoreduUctases b. transferases c. hydrolases d. ligases 28. They catalyze the hydrolysis of a bond. For example, the enzyme pepsin hydrolyzes peptide bonds in proteins. a. oxidoreductases b. transferases c. hydrolases d. ligases 29. Catalyze the association of two molecules. For example, DNA ligase catalyzes the joining of two fragments of DNA by forming a phosphodiester bond. a. oxidoreductases b. transferases c. hydrolases d. ligases 30. It is the loss of electrons, gain of oxygen or loss of hydrogen. a. reduction b. temperature C. substrate concentration d. oxidationAlpha-glucosidase inhibitors are contraindicated in all of the following cases, except:A. Diabetic ketoacidosisA. Liver cirrhosisB. HypertensionC. Large abdominal herniasD. Ulcerative colitis
- explain how α-tocopherol and ascorbate work together in suppressing the oxidation of polyunsaturated fatty acidsD-Gluconic acid is formed from D-Glucoge Select one:a. By substitutonb. By oxydationc. By esterificationd. By reductionIn the context of fatty acid oxidation to acetyl CoA, indicate whether each of the following substances is involved in (1) fatty acid activation, (2) fatty acid trans-port, or (3) b-oxidation pathway. More than one choice may be correct in a given situation. a. AMp b. FAD c. Acyl CoA d. H2O
- Consider the docosanoic acid, C21H43CO2H a. Label the a and B carbons b. Draw the acyl CoA derived from this fatty acid c. How many acetyl CoA molecules are formed by complete B-oxidation? d. How many cycles of B-oxidation are needed for complete oxidation? e. How many molecules of ATP are formed from the complete catabolism of this fatty acid?Which one of the following statements is not correct for the transamination reaction that amino acid contributed? a.Pyridoxal phosphate has a crucial role in transamination reactions. b.Enzyme levels may be high in liver and muscle diseases. c.Transamination reactions are catalyzed by aminotransferases. d.Alanine aminotransferase catalyzed reactions can be given as an example for transamination reactions. e.Transamination reactions are irreversible.A patient who has been drinking large amounts of alcohol for long periods of time shows thefollowing symptoms: apathy, loss of memory, and a rhythmical to-and-fro motion of the eyeballs.Which of the following reactions are most likely to be affected in the patient? A. Conversation of pyruvate to acetyl-CoA B. Conversation of a-ketoglutarate to succinyl-CoA C. Both A and B D. Neither A nor B