This is a required question10. What correctly describes the phosphate head of a phospholipid? *Non-polar and hydrophobicNon-polar and hydrophilicO Polar and hydrophobicO Polar and hydrophilic11. Which of these molecules are lipids? *1

Introduction In animal cell plasma membrane is the outermost covering which protects the cell from…

Answered: 10. What correctly describes the…

10. What correctly describes the phosphate head of a phospholipid? * Non-polar and hydrophobic O Non-polar and hydrophilic O Polar and hydrophobic O Polar and hydrophilic

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter4: Cell Structure

Section: Chapter Questions

Problem 5SQ

See similar textbooks

Related questions

Q: how many nucleotides are in CAGATTGTGAAGAGGTCTCTTGA consensus coding sequence? Answer in numerical…

A: Nucleotides are organic molecules made up of a phosphate and a nucleoside. They function as…

Q: Compare and contrast purebred and crossbred breeding options. Include the advantages and…

A: Breeding is a type of sexual reproduction where offsprings are produced. For example breeding or…

Q: Problem. In a practical session, students studied a stained blood smear of a mouse with bacteria…

A: Phagocytosis is a process of ingestion of nutrients or foreign substances inside the specialised…

Q: 4.2 Answer these "a, b, c" questions, well detailed with a lot of information filled in. It is…

A: Beluga whales are a unique and fascinating species that are found in Arctic and sub-Arctic waters.…

Q: The first product of genome expression is transcriptome but what happens if the RNA of the genes are…

A: Transcriptome is the collection of the all the RNAs both the coding and non-coding type present in a…

Q: The waved albatross feeds exclusively on marine organisms and has no access to fresh water. It has…

A: Albatrosses have salt glands just behind their eye sockets. This salt gland allows them to get rid…

Q: In relation to NSAIDs, describe the mechanism of how tissue damage leads to pain and how NSAIDs,…

A: Nonsteroidal anti-inflammatory drugs, or NSAIDs, are a widely used class of medications that are…

Q: Which of the following groupings of the abdominopelvic regions is medial? a. Hypochondriac,…

A: The ability to correctly interpret an X-ray film is crucial for medical professionals in order to…

Q: The reason LacZ is frequently used as a reporter gene is: a. The lacZ gene product binds to the…

A: LacZ is a gene of lac operon which codes for β-galactosidase. The reporter genes cause a visible…

Q: 3. When Mendel cross-fertilised tall purple-flowered pea plants with short white-flowered pea pla…

A: Mendel uncovered the fundamental laws of heredity. His experiments demonstrated that the inheritance…

Q: Describe briefly the levels of structural organization. Cellular level Chemical Level Tissue Level…

A: Structural organization refers to the way that different parts of an organism are arranged and how…

Q: In biological systems, anabolic and catabolic reactions are "coupled" (or linked) by: Glycolysis…

A: Various metabolic activities will continuously occur in body which is essential for proper…

Q: Why is there loss of protein synthesis in hypoxic injury to a cell?

A: Protein synthesis is the process by which cells use genetic information to build and assemble…

Q: During the process of double fertilization, the pollen tube grows into the ovule through an opening…

A: Sexual reproduction generally occurs in angiospermic plants.Double fertilization is an unique event…

Q: What is the definition for “greenhouse gas” ?

A: Carbon dioxide is an inorganic biomolecule composed of two oxygen atoms that form a double bond with…

Q: In moose, brown coat color (B) is dominant to albino (no pigment) (b) and rough coat (R) is dominant…

A: In genetics, dominant and recessive refer to the relationship between two versions of a gene, called…

Q: Problem #3 Hemophilia is a recessive trait carried on the X chromosome. What are the genotype and…

A: Hemophilia is a recessive disease meaning that when both the X chromosomes in females are affected…

Q: Differentiate between aneuploidy and polyploidy

A: Chromosomal variations refer to any changes or differences in the number or structure of chromosomes…

Q: Palivizumab is a humanized monoclonal anitbody for the prohylaxis of resporatory diseases caused by…

A: The virus is the submicroscopic infectious agent which infect the host cells like plant, animal or…

Q: Which of the following molecules is more likely to diffuse through a synthetic lipid bilayer (i.e. a…

A: Part A. The protein backbone is the repetitive structure with nitrogen, alpha-carbon and carbon…

Q: Name the connection between the hypothalamus and the posterior pituitary gland. What does it consist…

A: Pituitary gland is an endocrine gland that mainly consists of two lobes called anterior and…

Q: why doesnt this chi square value fit the number of expected with independent assortment?

A: Genetics can help us understand the evolution of species: By studying the genetics of different…

Q: Activation of the beta-gamma subunit associated with the Go protein complex would lead to what…

A: Ans) Closing of presynaptic Ca++ channels Option 1 is correct because the activation of the Go…

Q: When a food handler doesn't wash their hands after using the bathroom and introduces noravirus…

A: Introduction Any change in the body's physicality or function causing discomfort or disability is…

Q: What are the genotype and phenotype ratios of the potential offspring when a man who is heterozygous…

A: The man is heterozygous for type A blood - IAIB The woman is homozygous for type B blood - IBIB

Q: A snapdragon plant with violet flowers was crossed with another such plant with white flowers. The…

A: INCOMPLETE DOMINANCE It is a gene interaction in which both alleles of a gene at a locus are…

Q: Inductive reasoning begins with a theory -- is true or false? Research studies should never have…

A: In order to test the influence of factors on certain outcomes, experimental designs control…

Q: Direction: Read the following information and fill in the blanks. Water moves through membranes by…

A: In osmosis,water moves from region of higher water concentration to the region of lower water…

Q: Explain the steps of RNA translation into protein.

A: “Since you have posted multiple questions, we will provide the solutiononly to the first question as…

Q: Dihybrid Crosses - Genotypes NOW YOU KNOW THE RULES - FOR EACH PHENOTYPE SHOWN IN THE PICTURES, WORK…

A: Introduction A gene exists in two alternative forms known as allele. When both the alleles are same,…

Q: Unlock Your Answer the following questions. Explain your answer by citing references and evidence.…

A: The chemical process known as photosynthesis is used by plants, algae, and some bacteria to convert…

Q: 20. With respect to the Laws of Thermodynamics, what is the most important of the following roles of…

A: The process of photosynthesis takes place when the sunlight strikes the leaves and excites…

Q: The identity of Kim's biological father is unknown, but it is thought to be either Kevin or Thomas.…

A: DNA fingerprinting is a method of identifying an individual based on their unique DNA pattern. It…

Q: What is one of the determining factors in the three-dimensional structure of a protein? A.The…

A: Introduction:- There are different types of bio-macromolecules and bio-micromolecules present in…

Q: 8. At the conclusion of the Krebs Cycle, glucose is completely broken down, yet only a net of…

A: The Krebs cycle begins when acetyl-CoA reacts with a four-carbon molecule known as OAA…

Q: what's the difference between research and scientific investigatory project?

A: Research is a kind of detailed study about something. It is done to have a better outcome and a…

Q: 1. (a) In diploid organisms, haploid cells or gametes are produced by meiosis. Fig. 2.1 shows…

A: Introduction:- Meiosis is the process in which a single cell divides twice to form four haploid…

Q: Trace the development of a megaspore mother cell to the formation of mature embryo sac in a…

A: The development of the megaspore mother cell (MMC) is the formation of the mature embryo sac &…

Q: Table 2. Week 53 in Mars greenhouse. H Environmental data at 12:00 p.m. Note from Luke: I don't…

A: The above question is referring to environmental data collected in a Mars greenhouse during week 53.…

Q: What are the major benefits and the disadvantages of a rumen system? How does a cecal animal compare…

A: Rumen system is the ruminant digestive system. Ruminants are those who eat plants- herbivorous…

Q: explain how the skeletal, articular, and muscular systems work together to form the human skeletal…

A: Skeleton, articulates and muscles collectively forms musculoskeletal system also called as locomotor…

Q: What are the various methods that might be used to inactivate or eliminate chlorine-resistant…

A: Water treatment plants usually used conventional methods to purify the water such as filtration…

Q: I was told the correct answer is 0.006. Please advise why this one is diffrent

A: Introduction The fundamental piece of genetic information given from parent to child is the gene.…

Q: Explain how a transcriptional fusion to a reporter gene, combined with site directed mutagenesis,…

A: Studies of gene expression and promoter activity are frequently made easier with the aid of gene…

Q: We measure species density in plant ecosystems, When random sampling and systematic sampling…

A: Random sampling :- Random sampling is a type of the sampling technique in which each sample has an…

Q: 1. What is the independent variable in the experiment? Why? 2. What is the dependent variable in the…

A: Note: Please always mention the subparts needed in case of multiple questions. Thank you! Osmosis is…

Q: Question: Suppose the progeny were crossed. Fill in the Punnett Squares below and answer the…

Q: Which energy system did you use for 5 mins of jogging (around the house or up/down the stairs)? what…

A: Cellular respiration is an important metabolic pathway by which energy in the form of ATP is…

Q: What is the difference between coagulatiive and liquefactive necrosis? How are they related to…

A: Necrosis is referred to unprogrammed cell death due to a disease or an injury. It can affect many…

Q: Define the element based on its composition. I am currently in biolgy 141 general biology.

A: A chemical element is a species of atoms, including the pure substance made entirely of that…

Concept explainers

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

A group of BS Biology students were tasked to design and fabricate different synthetic cell membranes that could be used to simulate cellular activities of certain organisms. Below are the chemical structures of the compounds that are available to them: H2C-OH НС — ОН HO H2C-OH myristic acid glycerol НО alpha-linolenic acid HO-P-o OH orthophosphate HO NH2 sphingosine OH CH2OH NH3 CH2OH HO ethanolamine HO OH OH OH Но. lactose ("point of attachment) Given these compounds, help the students assemble the structure of the lipid constituent for the cell membrane appropriate to study the following. Briefly explain your answer. (Draw the structure) а. a thermophilic bacteria thriving in a hot spring b. a hepatocyte of a sea lion in the Arctic Ocean С. a frog neurocyte
Hi, can I please have an explanation about : if it would be possible for phospholipids to switch roles with triglycerides ? And similarities and differences in structures of phospholipids and triglycerides. Thank you!
H "H H H HO Choose all of the following are true of the given structure? (Choose all of the correct answers)
Proteins class question: Why is it rare to have crystal structures of heteromers of cyclic symmetry higher than 2-fold? This can be answered in 150 words or less. Please give me the correct answer with explanation quickly I will give you upvote
Thinking about cell membranes. a) The fatty acid tails of the phospholipids that make up cell membranes canbe either saturated or unsaturated. Which type of lipid will lead to a membranewith more mechanical strength? Explain your answer. b) One difference between bacterial and eukaryotic membranes is the presenceof cholesterol in eukaryotic membranes. What is the structure of cholesterol?Explain how adding cholesterol to a phospholipid membrane will affect thestability of the membrane. c) “Anammox” bacteria are unique in that they can perform anaerobic ammoniaoxidation, or the production of nitrogen gas from ammonia (Damasté et al. Nature2002, 419, 708.). Intermediates along this reaction pathway include hydrazine(N2H4) and hydroxylamine (NH2OH), both of which are extremely toxic to the cell.The ammonia oxidation reactions are believed to occur inside a membrane-bound structure within the cell called the “anammoxosome.” The structure of oneof the lipids of the anammoxosome is shown…
Lipids most abundant form are Triglycerides building blocks are 1 If a triglyceride only contains If a triglyceride contains one or more unsaturated fat. + The tail of this structure is made of 2 (hydrophobic). then it is classified as a saturated fat. The head of this structure is made of a single (hydrophilic). 4+ O Search Lipids are also responsible for a major component of the cell membrane wall that is both attracted to and repelled by water, called Their overall shape determines their The complex 3D shape of a protein is called a Proteins have four levels of structure: t -Ö:-- CD and 3 per molecule. bonds that contain the maximum number of + Proteins building blocks are amino acids that are held together with bonds. These are covalent bonds that link the amino end of one amino acid with the carboxyl end of another. T 09 bonds, then it is classified as an that are water insoluble + that is water soluble T F9 8 W F10 · C F11
(a). Phospholipids are amphipathic molecules which have hydrophilic and hydrophobic regions. Explain how this feature benefits the cell. (Give ONE reason) (2) (b). Give ONE difference between a saturated phospholipid and an unsaturated phospholipid. (2)
1- (True or False) Adjacent nucleotides are joined by covalent bonds that form between the –OH group on the 3` carbon of one nucleotide and the phosphate on the 5` carbon on the next. 2- (True or False) if a solute is in an aqueous solution, then by definition an hydration shell has formed around it. 3- (True or False) When exposed to water, phospholipids will self-organize into lipid bilayers, and spheres.
What's New Identify the different components of the cell membrane using the deacription given below. Use the appropriate number to locate each molecule. 1. Carbohydrate chain - 2 or more monosaccharide unit, either attached or branched found on the outside surface of the cell membrane. 2. Cholesterol found between the hydrophobic tails of the membrane phospholipid. 3. Glycolipid - carbohydrates attached to a lipid molecule. 4. Glycoprotein - carbohydrates attached to a protein molecule. 5. Integral Protein – protein embedded in the phospholipid bilayer that extend in both layers of the membrane. 6. Lipid Tail – the hydrophobic tail of the phospholipid facing the core of the membrane. 7. Peripheral Protein - protein found in the inner or outer surface of the membrane but not embedded on hydrophobic core. 8. Phosphate Head - globular hydrophilic head of the membrane.
Which of the following lipids would you expect to find as a structural component in a membrane, and with a net charge of zero at pH 7.3? phosphatidylserine. triacylglycerol. phosphatidylcholine. phosphatidic acid none of the above options.
Lipids Concept Map Add these terms to your concept map should include these concepts and details: Structure (functional groups, shape); Monomer; Linkage; Properties; Functions; Key terms from the Partial List of Key Terms from the Minds Partial Key Term List fatty acid glycerol triglyceride wax steroid amphipathic ester linkage phospholipid micelle bilayer mosaic independent variable dependent variable controlled variables glycolipid glycolprotein transmembrane protein
Which of the following descriptions is the best for a phospholipid? A polar lipid molecule that fully repels water through all its parts A lipid molecule that consists of two fatty acids, glycerol and a phosphate group and is amphipathic A polar lipid molecule that is made nonpolar by the addition of a phosphate group O A polar lipid molecule that fully interacts with water O A nonpolar lipid molecule that is made fully polar by the addition of a phosphate group so it can interact with water