1. Use the below pedigree chart to answer the following questions about dimples. The Dimple gene controls whether a person has dimples or doesn't have dimples. Dimples is dominant to no dimples. Place the genotypes of each individual below its symbol. male female 7 10 11 male femake Dimples gene (D) Dimples is dominant to no dimples 12 13 14 A) How many family members have Dimples? B) What is the genotype of individual #3 and 4? C) Can either individual #8 or 9 be homozygous? C) Explain the family relationship that #12 has with # 2.
Q: Using the table below, differentiate the effect of two varying pH levels (as indicated by by the…
A: Enzymes are affected by changes in pH. The most favorable pH value - the point where the enzyme is…
Q: He then ran the sample on an agarose gel and observed a strong band at approximately 400bp. What…
A: The band represent a small piece of DNA that was cut with restriction endonuclease and then…
Q: a week 301. How many calories will a 150-pound person burn if he/she walks 2 mph for 1 hour? (а) 240…
A: There are many ways to assess one's activities and give them numerical values for comparison from…
Q: populations of flightless grasshoppers (Population A and B) are separated by a river that contains…
A: This is a type of natural selection occurring here. Natural selection was a concept given first by…
Q: Identify four important factors in achieving efficient heat exchange in milk processin
A: Milk processing refers to the process of collecting milk from cattle, pasteurising, clarifying,…
Q: GEL ELECTROPHORESIS What is the purpose of gel electrophoresis?…
A: DNA, RNA and proteins are macromolecules. There are different techniques to separate them.
Q: List down the protected areas in REGION 12 (Soccsksargen), PHILIPPINES and the endemic species…
A:
Q: Discuss the types of meristems based on their position in the plant body
A: Introduction Meristem is a type of plant tissue that contains undifferentiated cells responsible for…
Q: What is the significance of Juxtaglomerular apparatus in kidney function.
A: Introduction - The kidneys are two bean-shaped organs located on either side of your spine, below…
Q: The titer of Lauren's phage is 3.7 X 108 pfu/mL. She diluted her phage lysate 1:10 from 10° to 10-7…
A:
Q: QUESTION 25 What is the value of identifying prevalent base changes found in different cancer types?…
A: Cancer is a fatal disease that has both physical and mental consequences for a person. Cancer can…
Q: A hypothetical population was found to have a genotype frequency of AA=20%, Aa=40%, aa=40%. If the…
A: The genotype of the population is a number of populations with the given genotype and is calculated…
Q: Which of the following is NOT a true statement? Action potentials are generated only when a neuron…
A: There are few important points that should be kept in mind: Neurons possess electrical excitability…
Q: What is the name of the site where RNA polymerase binds to the DNA prior to the beginning of…
A:
Q: You are studying a cell line that expresses both GPCR-A and G <-B, each receptc binds the same…
A: GPCR A increases cAMP and GPCR B decreases it. Hence any mutation affecting the GPCR B will be…
Q: A heart microslide demonstrates cells in the shape of pale chords, which have few myofibrilla,…
A: 2. ANSWER;- Contractile cells, Purkinje's fibers Explain;- Contractile cells conduct impulses and…
Q: You are recording from a touch receptor in skin. When you stimulate a spot on the skin, the receptor…
A: Answer :- Option (B) is correct. - Whether the receptor sends its output to the somatosensory cortex…
Q: Which of the following images shows a phage with a Siphoviridae morphotype? A) B) C)
A: Siphoviridae viruses are double stranded DNA viruses which belong to order Caudovirales. this family…
Q: Besides the Warrior gene, the only other genetic mutation directly correlated with “super-maleness”…
A: As mentioned in many scientific literature the warrior gene which is normally referred to as MAOA…
Q: Protein P, normally stimulates apoptosis or cell death when activated. Consider a cell with a…
A: The construction of this question gives us an information about the nature of protein P, P when…
Q: What would happen to a person whose body did not produce bile ?
A: Bile is the fluid which is synthesized and secreted by liver and stored in the gallbladder. Main…
Q: Nutrients in the soil, such as phosphorus and potassium, play an important role in plant…
A: “Nutrients are the compounds required and that provide energy, allowing to heal and in the…
Q: of the following is not an example of green infrastructu Pavement Bioswales Bioretention Planter…
A: Lack of greenery has made the life difficult. In order to promote greenery and conserve water, green…
Q: You are working with a yeast that can undergo fermentation or respiration. You take equal aliquots…
A: Introduction - Fermentation in yeasts produces ethanol and carbon dioxide, both of which can be used…
Q: AN
A: Male toad
Q: Explain briefly the mechanism of Magnetic Resonance Imaging (MRI) and how is Ampere's Law applied in…
A:
Q: Protein N, normally inactivates a tumor suppressor protein. Consider a cell with a mutation in one…
A: For tumour suppressor gene to be purely dysfunctional and leading to neoplastic genes, there need to…
Q: intensity €495 1295 567.5 567.9 1995 s
A: M/z means mass to charge ratio . The first step is involves selecting largest leaks in mass spectrum…
Q: design a bacterial/archaeal species, what would be its characteristics (e.g. shape, arrangement,…
A: Bacteria are small unicellular microorganism that lacks any proper cell organization (which means no…
Q: Explain and elaborate on hor metamorphosis influences insect parasitism.
A: Metamorphosis is a biological phenomenon in which the body structure of an animal changes rapidly…
Q: After fertilization the integument(s) of gymnosperms and angiosperms becomets O nutritive tissue O…
A: The integuments are the ovule's outer layer(s), which mature into a seed coat as the ovule matures…
Q: Organisms with favorable characteristics are more likely to survive and pass on their traits to…
A: Variation means genetic differenced between cells, individual organisms or group of organisms.…
Q: How can a person reduce their own food waste? O Use clean energy in food production facilities and…
A: Only buy food if you have a limited supply.Don't overcook your food.Refrigeration is a good way to…
Q: You are supplied with the following information about a DNA molecule: The molecular weight of a…
A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…
Q: Lungfishes Amphibians Mammals Amnion Lizards and snakes Crocodiles Ostriches Feathers Hawks and…
A: According to Bartleby guidelines , we are supposed to answer first three subparts in case of…
Q: If you cloned GFP under the control of the V. fischeri Lux promoter, when would you see GFP…
A: Vibrio fischeri exhibits bioluminescence only when the density of its cell is higher and…
Q: What is human Intelligence?
A: The ability of human brain or mental quality is basically the human intelligence. It includes the…
Q: kangaroos, the somatic cells are diploid, having 22 chromosomes. How many chromosomes are present in…
A: Every cell of our body is diploid. Germinal cells are diploid too but they undergo meiosis when…
Q: What is the significance of Juxtaglomerular apparatus in kidney function.
A: Answer : the significance of the juxtaglomerular apparatus in kidney function is to maintain the…
Q: What is biomass
A: Biomass is defined as the total quantity of plants in a particular area.
Q: Explain in detail the process of making beer with process flow diagram.
A:
Q: Jim hasn't been having success in growing strawberry plants for the past few years, so he got his…
A: The observation of the following experiment conducted by Jim is there is some problem with the soil…
Q: Describe and explain the major steps in the process ofwastewater treatment. How can artificially…
A: Introduction :- Wastewater treatment is the process of removing contaminants from wastewater and…
Q: 4. 16B (Eukaryotes): Describe 4 factors that differentiate eukaryotic chromosomes/genome from a…
A: Nucleus is a chief controller of the cell which carries genetic instructions . It comprises of…
Q: Assignment in Modules 4-6 Matching Type: Match Column A with Column B. Type the answer before the…
A: 1.The odor of the urine in cases of phenyl ketonuria - Y. Mousy odor 2.The odor of the urine in…
Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…
A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…
Q: 22. It is a microbial infection of the bladder. 23. It is the infection of the renal pelvis. 24. It…
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: ´A D. E В Coronal Suture [ Choose ] Supraorbital Torus [ Choose ] Mastoid Process [ Choose ] Mental…
A: In vertebrates, the cranium is a bony structure that creates the head. It creates a safe chamber for…
Q: A. Complete the table below by filling in the information you have learned from the concept on the…
A: There are two primary processes associated with the gene expression. Gene expression refers to the…
Q: Purified proteins can have their mW determined by: Ethanol precipitation O SDS-PAGE O going to taco…
A: The application of scientific and technical principles to the processing of the material by…
Step by step
Solved in 2 steps
- In individuals affected by cystic fibrosis, salt crystals may appear afterperspiration dries up. In addition, the disease causes respiratory disorderswhich can be both debilitating and lethal. It occurs in individuals homozygousfor recessive gene. If 2 normal parents had a daughter with the symptoms ofthis disease, and a normal son, what is the probability that he might be acarrier of the recessive gene?Express answer in fraction form.1. Use the below pedigree chart to answer the following questions about dimples. The Dimple gene controls whether a person has dimples or doesn't have dimples. Dimples is dominant to no dimples. Place the genotypes of each individual below its symbol. male female 6 7 8 10 11 male female Dimples gene (D) Dimples is dominant to no dimples 12 13 14 May 2 ||: 59 A) How many family members have Dimples? B) What is the genotype of individual #3 and 4? C) Can either individual #8 or 9 be homozygous? C) Explain the family relationship that #12 has with # 2.1 pts The pedigree below shows the expression of Huntington's disease in a family. Huntington's disease is a fatal genetic disorder that causes the progressive breakdown of nerve cells in the brain. It deteriorates a person's physical and mental abilities usually during their prime working years and has no cure. Huntington's is inherited as a dominant allele (H). Examine the pedigree below and determine the genotype for individual "2" DODO0O 2. O HH O Hh О h O either HH or Hh
- 1. The pedigree chart in Figure 5.29 shows the inheritance of haemopiu family. Study the pattern of inheritance in the pedigree chart, and then answer the questions that follow. о 5 6. 3 8 9 10 11 Key Unaffected male Haemophiliac male О Unaffected female Fig. 5.29 Pedigree chart of a family affected by haemophilia a) What is the genotype and phenotype of individuals 2 and 4? b) (i) How many of the unaffected family members are definitely carriers of the recessive allele? (ii) How are you able to tell which of the family members are carriers? (4) (1) (3) c) (i) If Individual 11 marries a carrier female, what percentage of their sons is likely to be haemophiliacs? (1) (ii) Use a genetic diagram to show how you worked out your answer in i, (6) 2. Why is haemophilia never passed from father to son, even though it is most common in males? (4) 3. Can a mother pass on a sex-linked gene to her daughter? (1) 4. Sipho has red-green colour blindness. One of his grandfathers was also. colour…1) Symptoms of 4 disorders are listed. Using the lists given, fill in the correct letter for the condition name and inheritance type. Letters may be used more than once. Symptoms Condition Inheritance Туре Loss of muscle control and decline in mental ability Shades of red and green are hard to distinguish Lack of skin pigmentation Cannot produce one of the necessary blood clotting factors Conditions: Inheritance Type: A: Albinism E: X-linked dominant B: Huntington Disease F: X-linked recessive G: Y-linked C: Hemophilia H: Autosomal dominant I: Autosomal recessive D: CVD6. The pedigree below traces the inheritance of a particular disorder. Circles are females, squares are males. Shaded symbols are affected with the disorder (NOTE: "half-shaded" symbols are NOT used here, for heterozygous individuals). What is the mode of inheritance of this disorder: is it dominant or recessive? Autosomal or X-linked? What is the genotype of the three numbered individuals? 1 2. 3.
- a. The ability to taste the chemical phenylthiocarbamideis an autosomal dominant phenotype, and the inabilityto taste it is recessive. If a taster woman with a nontasterfather marries a taster man who in a previous marriagehad a nontaster daughter, what is the probability thattheir first child will be(1) A nontaster girl(2) A taster girl(3) A taster boyb. What is the probability that their first two childrenwill be tasters of either sex?1. A woman is colorblind. Construct a Punnett square and using versions of the letter “C” determine if she marries a man with normal vision: What are the chances her sons will be colorblind? What are the chances her daughters will be colorblind? What are the chances of having a carrier daughter? 2. Both the husband and wife have normal vision. Their son is colorblind. What can you conclude about the father’s genotype? What about the mother’s genotype? Father: Mother: 3. If a young girl has fragile X syndrome, a recessive trait (f), what is her genotype? What are the possible genotypes of her father and mother? Mother: _________ or __________ Father: _________________ If her brother also developed this condition, which parent (father, mother, or both) contributed a disease allele? Explain your answer as well as constructing Punnett squares to support your answer. 4. Both the mother and father of a hemophiliac son have normal blood clotting. What are the genotypes of the…Albinism is a recessive autosomal trait for skin pigmentation. Hemophilia is a sex-linked recessivedisorder of the blood. assign alleles to the traitsA – normal skin pigmentation X H – normal blooda – albino X h - hemophilia A double heterozygous woman marries a non-hemophilic man and heterozygous for skinpigmentation. Double heterozygous means heterozygous for both traits. Aa for skin pigmentation andX H X h for blood trait. Therefore, the genotype of the woman is AaX H X h . Non-hemophilic man is X H Y and heterozygous for skin pigmentation is Aa. The genotype,therefore, of the man is AaX H Y. What is the probability that they will have:a. a child with normal skin? _____________________b. a child with normal blood? _____________________c. an albino girl? _____________________d. A hemophilic boy? _____________________
- A. Identify the inheritance pattern in the pedigree below (dominant, recessive or sex-linked). B. What are the genotypes for individuals Il- 1 and Ill-2? Use alleles A and/or a for your answer. 4 II 10 IVBlank 1) s the trait in this pedigree dominant or recessive? Blank 2) What is the genotype of the individual indicated by the red arrow? (Use the letter A Blank1 recessive Blank2 A9. Make a pedigree for each of the following situations. For each individual, write the individual's genotype (when possible) next to the individual's symbol (e.g. O xty, I Gg): a. Two parents do not have cystic fibrosis and they have a daughter with cystic fibrosis and a son who does not have cystic fibrosis. The daughter grows up and she mates with a male who does not have cystic fibrosis. Their only child is a boy and he has cystic fibrosis. b. A man with hemophilia mates with a female without hemophilia. They have one son and one daughter. The daughter has hemophilia and the son does not have hemophilia. The son grows up, and he marries and mates with a female. Their only child is a boy, and he has hemophilia.