1. Calculate the initial velocity (Vo) of a Michaelis-Menten reaction as a fraction of Vmax when [S] = 10Km, when [S] = 0.1Km.
Q: A.Provide the name for the D-monosaccharide “1” in the above image. You may ignore the alpha or…
A: There are four classes of biological macromolecule: nucleic acids, proteins, lipids and…
Q: Imagine a marine nitrogen fixing bacterium for the following questions. a. Calculate the cell’s…
A: INTRODUCTION : Marine nitrogen fixing bacterium - Marine N2 fixing bacterium(diazotrophs) convert…
Q: Amino acid analysis of a HEPTAPEPTIDE reveals the following information below: (NOTE: when the…
A: The proteins are composed of sequence of amino acids connected via peptide bonds. The sequence of…
Q: Enzyme X exhibits maximum activity at pH = 6.3. X shows a fairly sharp decrease in its activity when…
A: Most enzymes are proteins and proteins are primarily made up of amino acids. Amino acids bond with…
Q: What is ATP? in 5 sentences Why is ATP important in the body? in 5-7 sentences
A: There are many forms of energy. But living system needs one form of energy i.e., chemical energy.…
Q: Even in automated sequencing, where you can include all 4 ddNTPs in one reaction, you need to…
A: Introduction DNA acts as a genetic material in our body. DNA is a double stranded molecule. It is a…
Q: See the oligopeptide below. Compare the quantities of high energy molecules (e.g. ATP/ADP/AMP,…
A: Oligopeptides: It contains from two to twenty amino acids and may be made up of dipeptides,…
Q: What effect is seen on a Lineweaver-Burke graph when a competitive inhibitor is added to an…
A: Competitive inhibition is an enzyme inhibition process where an inhibitor molecule (similar to the…
Q: When doing automated sequencing, on the other hand, all 4 dideoxynucleotides are added to the same…
A: The genetic information is encoded in the sequence of DNA that is the genetic material. The Sanger…
Q: Which of the following statement is FALSE about enzymes? Enzymes are unconsumed during a biochemical…
A: Enzymes are biological catalysts that are utilized by metabolic reactions occurring in the living…
Q: 2. Enzymes A) have highest affinity for the substrate B) have highest affinity for the product C)…
A: In the enzyme active site is the region of the enzyme where the substrate binds and catalysis…
Q: 3. Show how the addition of an uncompetitive inhibitor would affect the reaction velocity and…
A: Enzymes are high molecular weight protein that catalyse biochemical reactions. They contain a active…
Q: Consider the pyruvate carboxylase reaction, the first bypass step in gluconeogenesis: Pyruvate + CO₂…
A: Gluconeogenesis is a process by which cells make glucose from non carbohydrate sources.…
Q: You are studying a protein, MSPaintase, which you suspect is a trimer composed of three different…
A: In size exclusion chromatography, species gets separated based on their size. The beads with pores ,…
Q: Identify the enzyme/protein involved in replication: multiple choice Addition of short RNA primers…
A: The DNA replication is the process of producing two identical copies of DNA from one original double…
Q: Ecol sticky end Putl SAATTCCTGCAGAAGCTT CITAA Synthetic polyliner Hindi N&CL Plasmid cloning vector…
A: The Enzyme Commission Number (EC Number) is a numerical classification for enzymes which is based on…
Q: How can an understanding of enzymes and biological receptors guide medicinal chemists? Match the…
A: It was long recognized as a differentiating feature of both drug and receptor, the selectivity of…
Q: Which of the following shows the structure of aspartic acid at pH 11? a H₂N. ОН ОН b H₂N ОН с H₂N ОН…
A: Aspartic acid (Asp or D); ionic form is known as aspartate, is an α-amino acid that is used for the…
Q: Describe the mechanism of feedback inhibition and the role this process plays in controlling enzyme…
A: The process of enzyme inhibition that is induced by the end product of a reaction to prevent the…
Q: Component 1 PCR buffer 2 MgCl2 3 dNTP mix 4 SSR forward primer 5 SSR reverse primer 6 Taq polymerase…
A: PCR is also known as a polymerase chain reaction which is generally used to amplify the template DNA…
Q: How can RNA sequencing (RNA-Seq) and Mirccorays in Transcriptome analysis find disease genes? Please…
A: Researchers can describe the transcriptional activity (coding and non-coding), concentrate on a…
Q: (b) To the right is a diagram of the chemical groups in carboxymethyl-cellulose and DEAE-cellulose…
A: We are given the list and quantity of amino acid residues on the iso-1 cytochrome c and iso-2…
Q: Increased ROS levels are a hallmark for Alzheimer's Disease. This is accurately described by all but…
A: Within a cell, reactive oxygen species are produced as a byproduct of oxygen metabolism and the cell…
Q: phosphate. Contrast the properties of hexokinases I and IV with respect to oligomeric structure,…
A: Hexokinase is an enzyme that has the ability to transfer inorganic phosphate group from ATP to the…
Q: 1.0 E oxygen saturation (Y) 0.6 0.4 0.2 0.0 20 40 60 blood pO₂ (torr) 80 100 120 for this picture…
A: Hemoglobin carries oxygen from the lungs to the tissues and CO2 from the tissues to the lungs. When…
Q: Acetyl-CoA is generated by E1 and E2 ... purpose of E3? (PDHC)
A: INTRODUCTION : Acetyl-CoA - It is a enzyme which is involved in many biochemical reactions of…
Q: What is meant by intrinsic GTPase activity? Exchange of GDP for GTP on the a-subunit of the G…
A: GPCRs interact with G proteins in the plasma membrane. G proteins are specialized proteins that can…
Q: A 100 mL solution of 0.1 M amino acid (AA) at pH 1.0 was titrated with 1.0 M NaOH solution. The pH…
A: Amino Acids: All amino acids have an amine and a carboxylic acid functional group with acid/base…
Q: Why might the compound shown below act as a transition state analog of phosphoglucose isomerase? A…
A: Phosphoglucose isomerase (PGI) is an enzyme belongs to class of isomerase enzyme which catalyzes…
Q: Benedict's test Green precipitate A. reducing sugars not presnt B. Reducing sugar presennt…
A: 1. Ans: A. Reducing sugar not presennt 2.Ans: B. Ketose present 3.Ans: A. Amlyose present
Q: At pH 5, what is the net charge of the pentapeptide Val-Glu-Cys-Ser-Lys? O-1 O 0 O +1 O +2
A: The amino acids contain ionizable groups. The ionic form of theses ionizable groups depends on the…
Q: 4. Below each item, identify WHAT it is, indicate WHERE in the cell it is used/made (cytoplasm or…
A: Glycolysis is the metabolic pathway that converts glucose into pyruvate. The free energy that is…
Q: For paper chromatography, the obtained Rf value of an amino acid with uncharged nonpolar R group is…
A: Chromatography is performed to separate a mixture of closely related substances. Paper…
Q: Describe various detection methods used in High-Performance Liquid Chromatography (HPLC) and types…
A: High-performance liquid chromatography or high-pressure liquid chromatography, is an analytical…
Q: Glyceraldehyde-3-phosphate + NAD+ + Pi → 1,3-bisphosphoglycerate + NADH + H+ ∆G0’ =+6.3 kJ…
A: In a general reaction such as: aA + bB ⇌ cC + dD The free energy changes in chemical reactions are…
Q: Look at this molecule and determine the number of molecules created from B-Oxidation: FADH2, NADH +…
A: Beta-oxidation is the process of degradation of fatty acids, in order to synthesize energy during…
Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…
A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…
Q: 1. Discuss how the pH and temperature affect the solubility of protein. 2. Explain "salting-in" in…
A: Proteins are large molecules made up of amino acid residues linked via a peptide bond. Amino Acids…
Q: Proteins destined for the peroxisomes can be translocated in their functional shape. True False
A: Protein targeting is a biological process by which the cells localize the proteins in different…
Q: In the figure below, Km is indicated at position labeled B Initial velocity (μM product/s) 50 45 40…
A: Km is Michaelis menton constant that corresponds to the substrate concentration at half maximal…
Q: The diagram to the right illustrates the inter-actions of the amino acid side chains of two…
A: Coiled coils are super secondary structures formed as 2 or more alpha helices twist around each…
Q: 385 What acts as a reductant in the glutamate synthase reaction to catalyze the transfer of the…
A: Reductant is a substance that donates electrons to another substance and reduce it. In an…
Q: PEP and 2-PG have similar amounts of potential metabolic energy with respect to decomposition to Pi,…
A: Glycolysis occurs in the cytoplasm of the cell. Glycolysis converts glucose into two molecules of…
Q: The PI of protein P is 7.3. One can purify protein P by:
A: The proteins are composed of twenty naturally occurring amino acids that are linked vis peptide…
Q: Which of the following peptides is most likely to serve as a signal sequence in human tissues a.)…
A: Peptides are polymers of amino acid residues linked via a peptide bond. Amino acids are…
Q: Supply the missing information DNA: 3' mRNA: anticodon: amino acids: TAC-CCG-TCG-GGG-CGT-ATA-ACT 5'…
A: Transcription is the process of synthesis of mRNA using one of the strands of the DNA. During this,…
Q: In most enzymes, the required active site amino acids consists of only a few residues. Why is the…
A: Enzymes are proteins that function as biocatalysts and catalyse biochemical reactions.They have a…
Q: 6-25 For Umax 57(Kr+S) constant an enzyme that displays Michaelis-Menten kinetics, what is the…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Sm When proteins are solubilized in inclusion bodies from an E Coli cell lysate, they are unfolded.…
A: Plasminogen is an important enzyme which is present in blood and degrades plama proteins like…
Q: The graph is 1/v over 1/s, Can you provide me the graph for V/S?
A: Enzymes are bio-catalyst that participate in biochemical process and they are highly specific in…
Step by step
Solved in 2 steps
- 1. Determine the Michaelis-Menten parameters of Vmax and Kỵ for the reaction S+E E.S E.S+W P+E The rate of reaction is given as a function of substrate: [S] 0.2 0.02 0.01 kmol/m³ -I'S kmol/m³.s E.S k₂E+S 0.54 0.28 0.19 0.005 0.1 0.002 0.0452. The Km of a particular enzyme is 2.0 x 105 M. If the initial velocity (Vo) is 0.16 mmol/min for [S] = 0.15 M, what will be the initial velocity when [S] =2.0 x 10+M?[References] In the following reaction, the rate of appearance of I, is measured at the times shown. 2HI(g) = H2(g) + I2(g) What is the initial rate of the reaction? Time (s) [I2], M 10. 0.42 20. 0.81 30. 1.2 Initial rate mol·L-l.s-1
- 1. Lyticase is an enzyme that breaks down cell membranes. It is particularly useful when harvesting proteins made in yeast or bacteria cells. In a series of 6 experiments, lyticase was used to break down cells at 40 °C, using different substrate concentrations. Determine the parameters from the Michaelis-Menten equation, Km and Vmax, for the reaction with data given below: (A) use a Lineweaver-Burk plot (B) use an Eadie-Hofstee plot (C) use a Hanes-Woolf plot (see textbook) [S], mmol/L 8.400 2.310 1.290 0.630 0.201 0.0720 reaction? v, mmol/(L-min) 0.0343 0.0254 0.0192 0.0140 0.00620 0.00250 (D) Which of the substrate concentrations used in the experiments above would achieve closest to a zero-order Note: when doing a trendline curve fit for data, if the equation coefficients show up with less than 3 significant figures (the slope and intercept), you should adjust the trendline equation format to switch to scientific or number with enough places after the decimal to get an accurate…Find the initial velocity for an enzymatic reaction when Vmax = 6.5 x 10–5 mol.sec–1, [S] = 3.0 x 10–3 M, and KM = 4.5 x 10–3 M.1. a. Calculate the physiological DG of the reaction shown below at 37°C, as it occurs in the cytosol ofneurons, with phosphocreatine at 4.7 mM, creatine at 1.0 mM, ADP at 0.73 mM, and ATP at 2.6mM. The standard free energy change for the overall reaction is –12.5 kJ/mol. Phosphocreatine + ADP ® creatine + ATP b. The enzyme phosphoglucomutase catalyzes the conversion of glucose 1-phosphate to glucose6-phosphate. Calculate the standard free energy change of this reaction if incubation of 20 mMglucose 1-phosphate (no glucose-6 phosphate initially present) yields a final equilibrium mixtureof 1.0 mM glucose 1-phosphate and 19 mM glucose 6-phosphate at 25°C and pH 7.0. c. If the rate of a nonenzymatic reaction is 1.2 x 10–2 μM s–1, what is the rate of the reaction at 37℃ inthe presence of an enzyme that reduces the activation energy by 30.5 kJ/mol?
- ch Select all statements that are correct. Note there might be more than 1 correct statement. From the Lineweaver-Burk plot the equilibrium constant (Keq) can be obtained The Lineweaver-Burk plot gives a more accurate prediction for Vmax than the Michaelis- Menten plot The Lineweaver-Burk plot assumes that products and reactants are present at equal concentrations during the entire time of the reaction The Lineweaver-Burk plot shows velocity of reaction vs substrate concentration The Lineweaver-Burk plot shows 1/velocity of reaction vs 1/substrate concentration O 20°C D) // E4. Make a conclusion about the practical reversibility of the reaction at 298K by calculating the constant for the reaction of ATP + AMP 2ADP, AGº=-2.10 kJ / mol.All of the following statements are true about the relationships between [S], Km and Vmax EXCEPT: а. As the [S] is increased, v approaches the limiting value, Vmax. b. Km= Vmax/2. The rate of the reaction, v, follows a first order rate equation v = K'[A] and K'= Vmax/Km. The rate of product formed, v, is at Vmax when [S] >> Km. с. d.
- The following data were obtained for a reaction that catalyzed by an enzyme: Initial concentration of 0.141 0.109 0.077 0.040 0.028 0.020 0.016 the enzyme [S], mol L- Relative velocity, V 22.0 20.5 19.0 12.5 9.0 7.0 6.0 For this reaction, the rate is found experimentally to follow the Michaelis-Menten equation: Vmax[S] Vo = Км+[S] (1) Transform the above equation into a straight-line equation. By plotting a suitable graph, determine the Michaelis constant (KM) and the maximal velocity (Vmax) for the above reaction. Determine the Vmax value when [S] = KM.2. (a) H2O (g) obeys the truncated viral equation of state given below at 400 K and up to 100 bar pressure. nRT n'RTB(T) P= + V Calculate the amount of work done as 2.00 mol of H2O (g) expands reversibly and isothermally from 2.00 to 50.0 dm³ at 400 K with B(T) = B(400 K) = -356 cm³ mol-'. (b) An ideal gas is expanded reversibly and isothermally. Decide which of q, w, AU, and AH are 0, positive, or negative.Calculate the standard free energy change (ΔG°′) for the following reaction: ½ O2 + FADH2 → H2O + FAD