Worksheet+4+MCB110 2
.pdf
keyboard_arrow_up
School
University of California, Berkeley *
*We aren’t endorsed by this school
Course
110
Subject
Biology
Date
Apr 24, 2024
Type
Pages
4
Uploaded by DoctorGrasshopperPerson1116 on coursehero.com
MCB110 Discussion
Week 5 Worksheet
GEL ELECTROPHORESIS
1.
You ran a DNA gel; however, you forgot whether or not the gel was denaturing or not. The
samples you ran are described below.
Lane 1: Ladder
Lane 2: Plasmid DNA isolated from E. coli
Lane 3: Linear ssDNA annealed to a shorter linear ssDNA strand
Lane 4: Linear dsDNA, both strands of equal length
Lane 5: A 100 bp linear ssDNA
Lane 6: A 100 bp linear ssDNA bound by SSBs
a.
Which of the samples will allow you to differentiate
between the gel being native or denaturing?
b.
Based on the gel to the right, did you run a native or
denaturing gel? How did you tell?
2.
You run the following gel and stain the gel with ethidium bromide after running. Your samples
contain plasmid DNA, a buffer with various cofactors, and an unknown enzyme. You incubated
your samples for differing amounts of time and ran
them on an agarose gel (Gel 1).
a.
Based on the banding pattern, what is most
likely to be this unknown enzyme?
b.
You go to repeat the experiment, but you
realize that you have run out of the buffer you
used before! In a pinch, you instead use
another unlabeled buffer given to you by a lab
member. Why does this gel (Gel 2) look
different?
MCB110 Discussion
Week 5 Worksheet
3.
You are studying the mismatch repair pathway
in vitro
(in a test tube). In all of your samples, you
have a linear, hemi-methylated piece of dsDNA which has a mismatch at a known site (mismatch
noted with an arrow and dashed line; methylated strand in gray). Only the unmethylated strand
(in black) is internally-labeled with radioactivity.
Samples:
Lane 1: Ladder
Lane 2: DNA only
Lane 3: DNA + MutS
Lane 4: DNA + MutS + MutH
Lane 5: DNA + MutS + MutH + MutL
Lane 6: MutS + MutH + MutL
a.
Draw the pattern you would expect to see below if these samples were run on an
alkaline agarose gel. Note, you give enough time for each enzyme to act on all
substrates.
b.
Describe how the gel would appear if you
instead internally labeled the methylated
strand.
c.
How would the gel appear if you instead end-labeled the unmethylated strand?
d.
Why is it beneficial to use a denaturing gel, rather than a native gel in this case?
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
- Access to all documents
- Unlimited textbook solutions
- 24/7 expert homework help
Related Questions
Submit
Q4.6. What does it mean to say that extension by DNA polymerase Ill proceeds 5' 3'?
The 5' end of a DNA polymerase molecule attaches to the 3' end of primase.
DNA polymerase adds nucleotides to a growing strand, moving in the 5'-→3' direction.
DNA polymerase seals nicks as it moves along a DNA strand toward the 3' end.
DNA polymerase can only synthesize DNA at the 5' end of an existing strand of DNA.
Submit
Q4.7. In DNA replication, what is the difference between thelleading and lagging strands?
In the leading strand, DNA is synthesized 5'-3', while in the lagging strand it is synthesized 3'-5'.
The leading strand is composed of DNA only, while the lagging strand is composed of both RNA and DNA.
After extension, the leading strand is continuous, while the lagging strand is composed of disconnected fragr
The leading strand is synthesized only by DNA polymerase II, while the lagging strand is synthesized only b
Submit
i DUO in thn nrocess of being replicated. The RNA primer is sho
arrow_forward
question on plasmid minipreps and restriction digestion
How does this procedure allow you to purify the plasmid DNA away from the chromosomal DNA?
arrow_forward
Lesson 2
Focus Questions
1. What chemicals and molecules are needed for PCR, and what is the function of each
component?
2. Examine the 150 base promoter sequence below.
Kaylee Kauff
5'TAGAAAAGGA AGGTGGCTCC TACAAATGCC ATCATTGCGA TAAAGGAAAG
GTATCATTC AAGATGCCTC TGCCGACAGT GGTCCCAAAG ATGGACCCCC
ACCCACGAGG AGC ATCGTGG AAAAAGAAGA CGTTCCAACC ACGTCTTCAA3'
Write in the sequence of the complementary strand and mark the 3' and 5' ends of the
complementary strand.
43
arrow_forward
WORKSHEET TASK 3:
1. Below is a theoretical section of DNA. Design two primers that are 10 base pairs (bp) long that will amplify this section of DNA in a PCR reaction (‘N’ refers to non-specific ‘nucleotide’).
3’–A C G T G A A C T G C C T NNN......NNN C C G T G T A T C T C T T–5’
5’–T G C A C T T G A C G G A NNN......NNN G G C A C A T A G A G A A–3’
arrow_forward
What conclusions can Melia and Sophie make about their phage Zucchinibread from this experiment?
arrow_forward
Task 1. Your graduate advisor asks you to amplify the following sequence of DNA by PCR:
5’-ATACGCATTCGGACCAGGTCCTAA-3’
3’-TATGCGTAAGCCTGGTCCAGGATT-5’
a. To ensure that the entire sequence above is amplified, what 6-nucleotide DNA primers
should you add to your PCR mix?
You order the primers listed above, but instead receive the following set of primers:
5’-CGCATT-3’
5’-GGACCT-3’
b. What portion of the double stranded DNA molecule will be amplified after 10 rounds of
PCR?
Your labmate attempts to rescue your PCR reaction by providing you with the following
set of primers:
5’-ATACGC-3’
5’-TCCTAA-3’
c. What is the result of running the PCR reaction with your labmate’s primers? How many
double stranded molecules of DNA will result from 10 rounds of amplification?
arrow_forward
Instructions:
Read 13-2 Manipulating DNA pages 322-323.
As you read each section, examine the figures and captions (explanations). Identify any
questions you may have.
1) Develop an analogy for the processes researchers use to make changes to DNA. In yo
analogy, explain how it is similar to the techniques used in genetic engineering.
You can draw a graphic organizer, make a table, or write a few sentences describing your
analogy.
2) Devise flowchart that shows the steps to prepare DNA for gel electrophoresis, as well
the protocol for setting up and running a gel. You can add diagrams to the flowchart an
add detailed notes if you like.
English (inited Sate)
O Focs
ere to search
4
CO
RU
G\
L
B.
2N
A\
Alt
Ciri
arrow_forward
Assignment_12.pdf - Adobe Reader
File Edit View Window Help
Оpen
1
/ 1
99,1%
Tools Fill & Sign Comment
3. Recombinant protein is produced by a genetically engineered strain of Escherichia coli during cell
growth. The recombinant protein can be considered a product of cell culture even though it is not
secreted from the cells; it is synthesized in addition to normal E. coli biomass. Ammonia is used as
the nitrogen source for aerobic respiration of glucose.
The recombinant protein has an overall formula of CH1.5500.31N..25. The yield of biomass (excluding
recombinant protein) from glucose is measured as o.48 g/g; the yield of recombinant protein from
glucose is about 20% of that for cells.
How much ammonia is required?
What is the oxygen demand?
If the biomass yield remains at 0.48 g /g, how much different are the ammonia and oxygen
requirements for wild-type E. coli that is unable to synthesize recombinant protein?
а.
b.
с.
24°C
08:39
Berawan
27/04/2022
arrow_forward
Questions
How are the nitrogenous bases held together across the middle of a DNA strand?
What types of molecules make up the backbone of a DNA molecule?
Procedure 6.1: DNA Replication. Read the procedure. You do not need the model kit. In fact, most of my students do not use it. Instead, you can just use paper and pencil and the letters for each DNA nucleotide: A, T, C, G.
arrow_forward
describe the structure of a plasmid
Chemistry
arrow_forward
Task 1: Compare the characteristics of DNA to RNA.
Think before you drop - This is an all or nothing type of question. Double check that you are happy with where you placed all of the options before you submit the knowledge
check.
DNA
RNA
No Answers Chosen
No Answers Chosen
DNA & RNA
No Answers Chosen
Possible answers
Phosphate group
| Cytosine
Adenine
Basic unit is the nucleotide
Single strand
Double helix
E Phosphate-sugar backbone
| Uracil
| Guanine
| Thymine
::::
::::
arrow_forward
Task 3: Agarose Gel Electrophoresis
Your amplicon from PCR was subjected to AGE for analysis. You are shown the image of the gel loaded with the following lanes: (A) negative control, (B) size ladder (1, 2, 3, 4, 6, and 10 kb), (C) gDNA extract, (D) PCR amplicon. However, due to mishaps while loading the gel with the samples, you are not sure which lane is which. You are shown a diagram of the obtained gel below.
a. b.
Label each lane of the gel. Write only the corresponding letters in the wells above. Above each band in the size ladder, write its size (in kb).
c.corresponding to the gene.
Approximate the size (in kb) of the polystyrenase gene. Write your answer above the band
Bonus: If you wish to identify the bacterial species in this scenario, what gene is most commonly and routinely sequenced?Answer: __________________________________
arrow_forward
question on plasmid minipreps and restriction digestion
What role does the combination of alcohol and salt play?
arrow_forward
Post lab questions
1) The approximate length of a DNA double helix is around 0.34nm per base pair. If the extracted DNA
was in the form of a single double helix, calculate how long it would be in meters. (1nm = = 10-⁹m)
Clear All Formatting
2) How long would it be in miles? (1mile = 1609.34m)
3) Is your double helix longer than the diameter of the Earth?
4) Is your double helix longer than the circumference of the Earth?
arrow_forward
Save On
13 2 Manipulating DNA pages 322_323 task - Last Modified: Mon at 1:11 PM -
Makama, Aisha B. MA
Home
Insert
Draw
Design
Layout
References
Mailings
Review
View
Help
A Share
1) Develop an analogy for the processes researchers use to make changes to DNA. In your
analogy, explain how it is similar to the techniques used in genetic engineering.
You can draw a graphic organizer, make a table, or write a few sentences describing your
analogy.
2) Devise flowchart that shows the steps to prepare DNA for gel electrophoresis, as well as
the protocol for setting up and running a gel. You can add diagrams to the flowchart and
add detailed notes if you like.
DFocus
9:46 PM
2122/2021
135 words
English (United States)
Page 1 of 1
P Type here to search
arrow_forward
Legrning Task 2: Make a.model of a DNA template to deternmine the seguence of bases in th new DNA strahds
Then, answer the gulde questions that follow.
Materials: crayons. Scissors, paste/tape, used folder or illustration board
Procedure:
Use the pattern of the DNA templater (attached to this LP). Color code, phosphate = blue, deoxyribose
sugar = green, nitrogenous base as follows: adenine= yellow, thymine = pink, guanine = violet, cytosine
= red. And cut the shapes of each nucleotides.
Buld a model of a strand of a DNA molecule. The strand should contain 6 base" rungs" following the given
order of the nucleotides: Guanine, Adenine, Cytosine, Thymine, Cytosine, Guanine.
Tape the cutout pattern to form the nucieotides. This will represent the left half of DNA.
Make a complementary strand that you made in step 3. Tape the cut -out pattern again forming the
nucieotides for the second strand of the DNA molecules.
Match the bases of the first strand and the second strand. Do not tape across…
arrow_forward
Question Completion Status:
QUESTION 25
DNA is
chemically stable than RNA due to the
on
more: 2-hydroxyl groups: RNA
more: 2'-hydroxyl groups: DNA
more; 3'-hydroxyl groups: RNA
less: 2'-hydroxyl groups: RNA
less: 2'-hydroxyl groups: DNA
arrow_forward
CHAPTER QUESTIONS
Q1: Choose the correct answer from the following
1. What is the basis of separation of different DNA fragments by gel electre
phoresis?
a. The positive charge on DNA
b. The size of the DNA fragments
C. The sequence of the fragments
d. The presence of a dye
2. Which of the following statements is accurate for DNA replication in veu
cells, but not PCR?
a. DNA primers are required.
b. DNA polymerase is stable at high temperatures.
C. Ligase is essential.
d. DNTPS are necessary
3. Why is the polymerase chain reaction used?
C. to ligate DNA
a. to amplify DNA
b. to cut'DNA
d. to separate DNA
4. For what purpose is DNA fingerprinting used?
a. to sequence DNA from bacteria
b. to separate DNA fragments
C.
to identify individuals who have committed crimes
d. to identify single nucleotide polymorphisms
5. Which of the following is used to cut DNA molecules in specific locations?
a. cloning vectors
b. cloning enzymes
C. restriction enzymes
d. polymerase chain reaction
6. What is…
arrow_forward
Activity 2. You COMPLETE Me!
Objective: Identify the methods used for inserting plasmids into the host cells.
What you need: pen and paper
What to do: On a separate sheet of paper, copy and complete the key points of the methods used
to introduce plasmids into the host cells. Choose your answers from the box
gene gun
biolistics
electric shock
mammalian cells
plasmid insertion by Heat Shock Treatment
increase the pore sizes of their plasma membranes
(2)
competent
plasmid DNA
Heat Shock
electroporation
There are three methods on introducing plasmids into the host cells namely: (1)_
(3)
Biolistics uses a (4)_ to fire DNA-coated pellets on plant tissues.
Plasmid insertion by Heat Shock Treatment is a process wherein target cells undergo a
The pretreatment is said to make the cells (6).
pretreatment procedure to (5)
the introduction of the (7)_
plasmid at about 4°C for about
30 minutes and the plasmids concentrate near the cells during
After the pretreatment, the cells are incubated with…
arrow_forward
Questions 17-20
A student uses restriction enzymes to cut a DNA molecule into fragments. The digested DNA is
loaded into the wells of an agarose gel and the gel is subjected to an electric current.
Upon completion of the run, the gel is stained.
17. The rate of migration of the DNA fragments through the agarose gel is determined by the
(A) ratio of adenine to cytosine in the fragment
(B) presence of hydrogen bonds between base pairs
(C) length of time the electrophoresis unit is allowed to operate
(D) number of nucleotides in the fragment
(E) volume of the starting sample
18. Which of the following is true of the dye used to stain the fragments?
(A) It increases the contrast between the agar and the DNA fragments.
(B) It must be accounted for when calculating the molecular weight of the fragments.
(C) Its charged areas interfere with the migration of the DNA.
(D) It is bonded only to the sticky ends of the fragments and can directly determine the
sequence of the DNA fragments.
(E) It…
arrow_forward
Questions 17-20
A student uses restriction enzymes to cut a DNA molecule into fragments. The digested DNA is
loaded into the wells of an agarose gel and the gel is subjected to an electric current.
Upon completion of the run, the gel is stained.
17. The rate of migration of the DNA fragments through the agarose gel is determined by the
(A) ratio of adenine to cytosine in the fragment
(B) presence of hydrogen bonds between base pairs
(C) length of time the electrophoresis unit is allowed to operate
(D) number of nucleotides in the fragment
(E) volume of the starting sample
18. Which of the following is true of the dye used to stain the fragments?
(A) It increases the contrast between the agar and the DNA fragments.
(B) It must be accounted for when calculating the molecular weight of the fragments.
(C) Its charged areas interfere with the migration of the DNA.
(D) It is bonded only to the sticky ends of the fragments and can directly determine the
sequence of the DNA fragments.
(E) It…
arrow_forward
question: Can you summarize and explain for me what you want to tell in the article below? Can you explain the figure? When I read it myself, I do not understand exactly what is meant by the article. It would be nice if you could highlight the important points. You can use them in a figure or diagram to explain. thank you and hava a nice day :)
Article:
Nanotechnology Tools to Detect SARS-CoV-2
Standard procedures for detecting the virus from nasopharyngeal and/or oropharyngeal swabs have been reviewed recently and are primarily based on reverse transcription polymerase chain reaction (RT-PCR). Here, we would like to mention some preliminary ideas on nanotechnology-based assays to monitor the presence of SARS-CoV-2. A simplified test and variants thereof to detect viral proteins (e.g., HIV or influenza virus) without the need for expensive equipment is based on the color change of Au NPs bound to antibodies. Similar to the enzyme-linked immunosorbent assay (ELISA) antibodies coupled…
arrow_forward
Assignment SummaryIn this assignment, you will think of scientific questions that will help you better understand the role ofDNA and chromosomes in the expression of heritable traits in an organism. You will then conductresearch to answer these questions. Finally, you will compose a typewritten document that states yourquestions and provides your answers.Background InformationDNA in the nucleus of a cell contains the genetic code that dictates the structure and function oforganisms. DNA is compressed into structures called chromosomes. Chromosomes are made ofsegments of DNA called genes. Genes are the basic units of heredity in organisms and are transferredfrom parent to offspring.DNA contains the genetic code, or the set of instructions, in the form of triplet codons, for assemblingamino acids into proteins. All organisms share a similar genetic code based on the same DNA codons.The order of the codons differs, allowing for diversity among organisms.Not all DNA codes for proteins.…
arrow_forward
Please answer fast
After the transfer of the F plasmid is complete
multiple choice 3
the F+ cell becomes F-.
the F- cell becomes F+.
F+ cell becomes antibiotic sensitive.
the F+ cell expresses an R factor.
the F- cell becomes HfR
arrow_forward
Question (1)-Describe the three different methods of horizontal gene transfer among bacteria and mention their significance.
Be specific when discussing the donor versus recipient cell, and if the donor and recipient cells are still alive after each horizontal gene transfer event is complete.
*Please go into detail if possible on what the donor and recipient cells if they are still alive also after each gene transfer. I have a test coming up that I’m trying to learn all I can about this. Thank you so much!*
arrow_forward
I need help with some questions for my biology homework.
1. What is the difference between leading and lagging strand?
2. DNA replicated in a ______ mode
3. Transcribe and translate the DNA. Is the coding strand
5’ACCTACCCATGCTCGATAAATGAAGTTCATTTTGACAAGAC
4. How many ATPS will be used to make a protein that is 100 amino acids long
5. In a cell a certain specific gene needs to transcribed. The cell activates this genes by acetylating histone. How is this helpful in activating the gene
arrow_forward
Question Completion Status:
Which of the following experiments suggested DNA was the transforming principle?
O Avery, MacLeod, and McCarty
O Beadle and Tatum
O Mendel
O Altmann
QUESTION 19
Which of the following is not true of DNA?
O DNA is single stranded
O DNA is double stranded
DNA strands are antiparallel
O DNA is composed of nucleotides
QUESTION 20
What type of RNA is a part of ribosomes?
TRNA
O FRNA
MRNA
dsRNA
Click Save and Submit to save and submit. Click Save All Answers to save all answers.
P Type here to search
立
arrow_forward
31_30*_SP23 - General Biology I (for m
24
ed
out of
nove flag
evious page
A
$
Transcribe the following DNA: TACGGGGCTGAGATT
Select one:
O a. UACGGGGCUGAGAUU
O b. Tyr-Gly-Ala-Glu-lle
C. Met-Pro-Arg-Leu-STOP
O d. AUGCCCCGACUCUAA
MacBook Air
arrow_forward
QUESTION 1
Questions 1-5. Please fill in the blank below with the corresponding structures indicated below in the diagram:
Please ignore the fact that the fragments are colored blue and green. The coloration has no significance to this question.
Also, please don't forget to answer question 61
1. Leading strand=
2. Lagging strand=
3. A single Okazaki fragment=
4. 3' end of fragment labeled "H"=
5. Replication fork=
H
E
G
6. How many primers are required to replicate all of the DNA fragments in the above diagram (include both lagging and
leading strand)?=
arrow_forward
BIOTECHNOLGY
Date:
Name:
Instructor:
Section/Group:.
POST-LAB QUESTIONS
1. In one or two sentences, summarize the technique of gel electrophoresis.
2. How does the process of gel electrophoresis separate DNA fragments?
3. Why is the fact that DNA has a negative charge so important in the gel electrophoresis process?
Biotechnology 165
arrow_forward
Task 2.1. Complete the table provided by comparing the Eukoryotic and Prokaryotic cel.
CRITERION
PROKARYOTIC CELL
EUKARYOTIC CELL
1. Nucleus
2. Chromosomes
3. Lysosomes and
Peroxisomes
4. Genetio
Recombination
5. Microtubules
6. Endoplasmic
Retioulum
7. Mitochondria
8. Cytoskeleton
9. DNA wrapping
on proteins
10. Ribosomes
11. Golgi opparatus
12. Chioroplosts
13. Organ/s of
locomotion
14. Cell wall
15. Vocuoles
16. Cell size
arrow_forward
I want to know how can I make RNA transcript through next dna sequencing.
5'ATGATCTTTAAAGGGCCC 3'
arrow_forward
URGENT
Conjugate base questions
arrow_forward
Questions:1. Why are plasmids used as vector for DNA Recombination? What other vectors can be used? 2. How are Recombinant DNA formed?3. What is the difference between genetic modification and selective breeding?
arrow_forward
McGraw-Hi
P Question 17
B.
What is happening at letter "C"?
O RNA Primase is laying down some RNA Primer on the lagging strand
O DNA Ligase is joining two Okazaki Fragments together
O DNA Polymerase III is making a new DNA strand on the leading strand
O DNA Polymerase I is removing RNA Primer and replacing it with DNA on the lagging strand
Ouestion 18
11
MacBook Pri
B.
arrow_forward
question: Can you summarize and explain for me what you want to tell in the article below? When I read it myself, I do not understand exactly what is meant by the article. It would be nice if you could highlight the important points. You can use them in a figure or diagram to explain. thank you and hava a nice day :)
Article:
Interference with Cellular Uptake, Immobilization, and Inactivation of the Virus Outside of the Host Cell
Nanomaterials can be synthesized with a high specific surface area of a few hundred square meters per gram. Therefore, dependent on the surface properties, nanomaterials efficiently adsorb biomolecules and form a so-called biomolecular corona. This passive, nontargeted adsorption might be utilized to bind viruses, provided that the selected nanomaterial is relatively biocompatible. Viral surface proteins are often modified by sugar moieties or encompass positively charged amino acid patches that bind to lectins or glycosaminoglycans (GAGs) of heparan sulfate…
arrow_forward
SEE MORE QUESTIONS
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Related Questions
- Submit Q4.6. What does it mean to say that extension by DNA polymerase Ill proceeds 5' 3'? The 5' end of a DNA polymerase molecule attaches to the 3' end of primase. DNA polymerase adds nucleotides to a growing strand, moving in the 5'-→3' direction. DNA polymerase seals nicks as it moves along a DNA strand toward the 3' end. DNA polymerase can only synthesize DNA at the 5' end of an existing strand of DNA. Submit Q4.7. In DNA replication, what is the difference between thelleading and lagging strands? In the leading strand, DNA is synthesized 5'-3', while in the lagging strand it is synthesized 3'-5'. The leading strand is composed of DNA only, while the lagging strand is composed of both RNA and DNA. After extension, the leading strand is continuous, while the lagging strand is composed of disconnected fragr The leading strand is synthesized only by DNA polymerase II, while the lagging strand is synthesized only b Submit i DUO in thn nrocess of being replicated. The RNA primer is shoarrow_forwardquestion on plasmid minipreps and restriction digestion How does this procedure allow you to purify the plasmid DNA away from the chromosomal DNA?arrow_forwardLesson 2 Focus Questions 1. What chemicals and molecules are needed for PCR, and what is the function of each component? 2. Examine the 150 base promoter sequence below. Kaylee Kauff 5'TAGAAAAGGA AGGTGGCTCC TACAAATGCC ATCATTGCGA TAAAGGAAAG GTATCATTC AAGATGCCTC TGCCGACAGT GGTCCCAAAG ATGGACCCCC ACCCACGAGG AGC ATCGTGG AAAAAGAAGA CGTTCCAACC ACGTCTTCAA3' Write in the sequence of the complementary strand and mark the 3' and 5' ends of the complementary strand. 43arrow_forward
- WORKSHEET TASK 3: 1. Below is a theoretical section of DNA. Design two primers that are 10 base pairs (bp) long that will amplify this section of DNA in a PCR reaction (‘N’ refers to non-specific ‘nucleotide’). 3’–A C G T G A A C T G C C T NNN......NNN C C G T G T A T C T C T T–5’ 5’–T G C A C T T G A C G G A NNN......NNN G G C A C A T A G A G A A–3’arrow_forwardWhat conclusions can Melia and Sophie make about their phage Zucchinibread from this experiment?arrow_forwardTask 1. Your graduate advisor asks you to amplify the following sequence of DNA by PCR: 5’-ATACGCATTCGGACCAGGTCCTAA-3’ 3’-TATGCGTAAGCCTGGTCCAGGATT-5’ a. To ensure that the entire sequence above is amplified, what 6-nucleotide DNA primers should you add to your PCR mix? You order the primers listed above, but instead receive the following set of primers: 5’-CGCATT-3’ 5’-GGACCT-3’ b. What portion of the double stranded DNA molecule will be amplified after 10 rounds of PCR? Your labmate attempts to rescue your PCR reaction by providing you with the following set of primers: 5’-ATACGC-3’ 5’-TCCTAA-3’ c. What is the result of running the PCR reaction with your labmate’s primers? How many double stranded molecules of DNA will result from 10 rounds of amplification?arrow_forward
- Instructions: Read 13-2 Manipulating DNA pages 322-323. As you read each section, examine the figures and captions (explanations). Identify any questions you may have. 1) Develop an analogy for the processes researchers use to make changes to DNA. In yo analogy, explain how it is similar to the techniques used in genetic engineering. You can draw a graphic organizer, make a table, or write a few sentences describing your analogy. 2) Devise flowchart that shows the steps to prepare DNA for gel electrophoresis, as well the protocol for setting up and running a gel. You can add diagrams to the flowchart an add detailed notes if you like. English (inited Sate) O Focs ere to search 4 CO RU G\ L B. 2N A\ Alt Ciriarrow_forwardAssignment_12.pdf - Adobe Reader File Edit View Window Help Оpen 1 / 1 99,1% Tools Fill & Sign Comment 3. Recombinant protein is produced by a genetically engineered strain of Escherichia coli during cell growth. The recombinant protein can be considered a product of cell culture even though it is not secreted from the cells; it is synthesized in addition to normal E. coli biomass. Ammonia is used as the nitrogen source for aerobic respiration of glucose. The recombinant protein has an overall formula of CH1.5500.31N..25. The yield of biomass (excluding recombinant protein) from glucose is measured as o.48 g/g; the yield of recombinant protein from glucose is about 20% of that for cells. How much ammonia is required? What is the oxygen demand? If the biomass yield remains at 0.48 g /g, how much different are the ammonia and oxygen requirements for wild-type E. coli that is unable to synthesize recombinant protein? а. b. с. 24°C 08:39 Berawan 27/04/2022arrow_forwardQuestions How are the nitrogenous bases held together across the middle of a DNA strand? What types of molecules make up the backbone of a DNA molecule? Procedure 6.1: DNA Replication. Read the procedure. You do not need the model kit. In fact, most of my students do not use it. Instead, you can just use paper and pencil and the letters for each DNA nucleotide: A, T, C, G.arrow_forward
- describe the structure of a plasmid Chemistryarrow_forwardTask 1: Compare the characteristics of DNA to RNA. Think before you drop - This is an all or nothing type of question. Double check that you are happy with where you placed all of the options before you submit the knowledge check. DNA RNA No Answers Chosen No Answers Chosen DNA & RNA No Answers Chosen Possible answers Phosphate group | Cytosine Adenine Basic unit is the nucleotide Single strand Double helix E Phosphate-sugar backbone | Uracil | Guanine | Thymine :::: ::::arrow_forwardTask 3: Agarose Gel Electrophoresis Your amplicon from PCR was subjected to AGE for analysis. You are shown the image of the gel loaded with the following lanes: (A) negative control, (B) size ladder (1, 2, 3, 4, 6, and 10 kb), (C) gDNA extract, (D) PCR amplicon. However, due to mishaps while loading the gel with the samples, you are not sure which lane is which. You are shown a diagram of the obtained gel below. a. b. Label each lane of the gel. Write only the corresponding letters in the wells above. Above each band in the size ladder, write its size (in kb). c.corresponding to the gene. Approximate the size (in kb) of the polystyrenase gene. Write your answer above the band Bonus: If you wish to identify the bacterial species in this scenario, what gene is most commonly and routinely sequenced?Answer: __________________________________arrow_forwardarrow_back_iosSEE MORE QUESTIONSarrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education