DNA Structure and Function

5 X O https://student.masteryconnect.com/?iv it41199tzPsQ_21hXG6OXABtokesw7jBW 912 Approved Sites SCS 21-22 SCI BIO District CFA2 Perez Jimenez, Dorian 00 4 of 20 The diagram shows the structure of DNA with complementary base pairing between strands. What is the benefit of this complementary nature of DNA? O It helps in controlling the amount of protein produced by the cells. O It helps in storing all the information required for the cell to function efficiently. It helps in the synthesizing of two new identical DNA strands from each parent strand O I t helps in the unwinding of DNA allowing for the formation of chromosomes during mitosis Type here to search

7:07 1 How Mutations Occur (Developing) Question O Practice It! /// A Select the statement(s) that accurately describe the function of DNA polymerase and the types of mutations that may occur. O Point mutations occur when a single nitrogenous base is substituted. Frameshift mutations occur when a nitrogenous base is inserted or deleted. start d le O Point mutations are less serious than frameshift mutations, as only a single base pair is affected. DNA has rare mutations during replication because DNA polymerase functions to build and repair errors in nitrogen base pairings of A-G and T-C. 3 Pro O DNA has rare mutations during replication because DNA polymerase functions to build and repair errors in nitrogen base pairings of A-T and G-C. O Point mutations occur when a nitrogenous base is inserted or deleted. Frameshift mutations occur when a single nitrogenous based is substituted. B.McKenzie - Uncontrolled Cell Growth B.McKenzie - Uncontrolled Cell Growth B.McKenzie - Uncontrolled…

Life Sciences February 2021 NSC - Grade 12 Informal test 2 (DNA) QUESTION 3 3.1 The diagram below represents protein synthesis that takes place in a human cell. In the diagram, the first 7 triplets of nitrogenous bases that form part of the gene coding for one chain of the haemoglobin (protein) is represented. DNA template 1 2 3 4 5 6 CÁC GTG GAC TGA GGA CTC CTC |8 CAC 9 10 11 GAG GAG MRNA GTG CAC CTG ACT CCT GAG GAG How many of the following are coded for in the DNA template sequence represented in the above diagram: 3.1.1 (a) RNA nucleotides (1) (b) Genes (1) (c) Amino acids (1) Write down the nitrogen base sequence of mRNA triplets labelled 8–11. 3.1.2 (4) Using the table below, determine the amino acid sequence coded by triplet number 1 to triplet number 4. 3.1.3 Anticodons on tRNA Amino acid CUỤC Glutamate GUG GGA GAC Histidine Proline Leucine UGA Threonine CAC Valine (4) (11) TOTAL SECTION6 B6 GRAND TOTAL: 40 50 Copyright reserved

Tn Midterm test Fall 2020 (page 2 of x A elearn.squ.edu.om/mod/quiz/attempt.php?attempt3D1335328&cmid%3D6971498page=1 SQU E-leaning System (Academic) Question 21 The direction of mRNA molecule synthesis is .: Not yet answered Select one: Marked out of O a. From DNA strand that starts with 5' 1.00 O b. In the direction of 3' to 5 P Flag question O c. From DNA strand that starts with 3' O d. From RNA strand that starts with 3' O e. From RNA strand that starts with 5' Question 22 Which of the following organelles do plants and animals have in common? Not yet answered Select one: Marked out of O a. mitochondria, ribosome, nucleus, cell membrane, cytoplasm 1.00 O b. mitochondria, vacuole, nucleus, cell membrane, cell wall F Flag question O c. mitochondria, vacuole, nucleus, cell membrane, centrioles O d. mitochondria, vacuole, nucleus, cell membrane, cell wall, chloroplasts O e. mitochondria, vacuole, nucleus, cytoplasm, cell wall, lysosome

common-assessment-delivery/start/4797160920?action=onresume&submissionld%-468979669 English 9 Student D. S ddddddddddddddd... Type of Genetics Cr. S TEWWG Chapter DNA Protein Synthesis Test Chromosome Free Nucleotides DNA Polymerase Leading Strand Original- (Template DNA) Helicase Lagging Strand Replication Fork Adenine Thymine Guanine Cytosine DNA Polymerase Original (Template) DNA Strand 1. This diagram is showing the process of 2. 1f the original template strand reads: TTACGCAGT, DNA polymerase would add nucleotides in the order: 4 5 6 7 8. 9 10

DNA GAAGGGACAATACTTTCTTAACACTTG MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis? Conclusion Questions: 1. Examine the protein you created. If the DNA strand that you started with had a change in it (A changed to G), what would happen to the protein made?

384 Answer all the questions below please! Required: At least 3-4 sentences for each answer Write answers in your own words (don't copy the answers directly) Choose one of the questions below to write a follow-up question Structure and Function of DNA and RNA Q2.1- Hydrogen bonds can form with bases on the opposite DNA strands in the double helix, or between the bases and H2O in the single stranded conformation. Considering that the double helix is the most stable conformation in water, how does this observation support the conclusion that base stacking contributes more to helix stability than interbase hydrogen bonding? Amino Acids and Peptides Q2.2-Using Table 4.3, list the amino acids that will carry a net charge at pH 7 within a protein. What is the charge at pH 7 for each of the amino acids you have listed (-2, -1, +1, etc.)? What is the net charge at pH 7 of the tetrapeptide shown in figure 4.17?

Question:- 1. ATT GAC CAA ATC CAT TGA GAC CAA What chains occur when modified DDTP thymine is added to the DNA sequence above.

18:20 O O OO0 • 4G+ * ll 7% Restriction enzyme tutorial 2021_1_ - Saved 1. Calculate the size of the resulting fragments as they will occur after digestion and write the sizes on the maps below. Note that linear DNA has a total size of 48 502 bp (see figure 3A). %3D B BamHI 5305 22,346 27,972 34499 41,732 op) ECORI, 21,226 26,104 31,747 39,168 44,972 (bp) D Hindll 23,130 27,479 36,895 37,584 44141 25,157 (bp) 37,459 2. How many fragments would you expect to see for each of the maps indicated in question 1 above? Мар В: Мар С: Мар D: 3. Use the sequence indicated in figure 1 (also refer to figure 2 and 3) and indicate how many times does the sequence GAATTC occur in the A DNA sequence? What about AAGCTT and GGATCC? GGATC: GAATTC: АAGCTT: B IU e A = E

- Addin X O Informational Rese X E credible source act X Y Muhammad | Biogr X W Muhammad - Brita X mi.instructure.com/courses/25527/assignments/4743473 Due Wednesday by 11:59pm Points 100 Submitting an external tool Your progress has been saved Question 1 of 9 Which of the following statements are true about DNA polymerase? Select all that apply. O On the leading strand, it works toward the replication fork. O It adds nucleotides from the 5' end of the DNA toward the 3' end. O On the lagging strand, it works away from the replication fork. O It starts replication at one end and then switches sides and continues on to the other strand. « Previous

31_30*_SP23 - General Biology I (for m 24 ed out of nove flag evious page A $ Transcribe the following DNA: TACGGGGCTGAGATT Select one: O a. UACGGGGCUGAGAUU O b. Tyr-Gly-Ala-Glu-lle C. Met-Pro-Arg-Leu-STOP O d. AUGCCCCGACUCUAA MacBook Air

Third letter UCAG UCAGH CAC First letter Part 5: Coding Practice 1. Use this sequence of DNA to answer the following former test questions: 5'-- TTAATGGGACAGCTTGTGTAGAGG --3' a. What is the complementary strand of DNA? b. Using the complementary strand of DNA (your answer from part a) as the template strand, what is the transcribed mRNA sequence? C. What is the amino acid sequence translated from the strand of mRNA synthesized in part b (use the genetic code below)? Remember: i. Start codon! ii. Stop codon! bac ocent Seond letter UUU Phe UAU Tyr UGU UGC Cys UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp G C. UUA UCA UUG Le UCG [ CAU ] CAC CUU CGU His CUC C CGC ne. CCA Arg Pro CUA CAA CGA CCG CAG Gin CGG CUG AAU 1 AAC Asn ACU AGU [ [ AUU AUC Ile AGC Ser Thr A AUA AGA AGG ACA AAA Arg AUG Met ACG AAG GUU GCU GAU GGU Asp GAC GCC GGC GUC Val G GUA GCA Ala GAA GGA Gly GAG Glu GGG GUG GCG

1_30*_SP23 - General Biology I (for majors)/1 of us page The anticodon sequence created from the following DNA: TACGGGGCTGAGATT F1 Select one: O a. Tyr-Gly-Ala-Glu-lle O b. AUGCCCCGACUCUAA c. UACGGGGCUGAGAUU O d. Met-Pro-Arg-Leu-STOP F2 # 80 F3 $ 000 000 F4 % F5 MacBook Air F6 & r F7 DII F8

Instructions: Read 13-2 Manipulating DNA pages 322-323. As you read each section, examine the figures and captions (explanations). Identify any questions you may have. 1) Develop an analogy for the processes researchers use to make changes to DNA. In yo analogy, explain how it is similar to the techniques used in genetic engineering. You can draw a graphic organizer, make a table, or write a few sentences describing your analogy. 2) Devise flowchart that shows the steps to prepare DNA for gel electrophoresis, as well the protocol for setting up and running a gel. You can add diagrams to the flowchart an add detailed notes if you like. English (inited Sate) O Focs ere to search 4 CO RU G\ L B. 2N A\ Alt Ciri

12:26 AM E G M 46 l i72% SCIG10_ACTIVITYSHEET_Q3W4.pdf Let's Evaluate: A. Multiple Choice: Encircle the letter of your chosen answer. For numbers 1-3 refer to the statement: The following is the base sequence on one strand of a DNA molecule: AAT GCC AGT GGT 1. If this strand is replicated, which of the following is the complementary strand that is produced? A. TCG TCC GTC TAG C. TTA CGG TCA CCA B. AGC AGG CAG GGT D. UCG UCC UCU AGA 2. If transcribed into an mRNA, what would be the resulting strand? A. UUA CGG UCA CCA C. AGC AGG CAG AUC B. AGC AGG AGA T C D. TCG TCC GTC TAG 3. During translation, the tRNA sequence of nucleotides arranged linearly is A. TCG TCC GTC TAG C. AGC AGG CAG AUC B. AAU GCC AGU GGU D. UCG UCC GỤC UAG 4. How many codons are needed to specify three amino acids? В. 6 А. 3 С. 9 D. 12 5. Some events that take place during the synthesis of a specific protein are listed below. I. Messenger RNA attaches to a ribosome. II. DNA serves as a template for RNA production. III.…

G-Unit 5: DNA anc X https://docs.goog x y google classroom x A Classes QLSeyPC6Kmoa0k5JJd1DWGzqqRwaQQobHNOOdqFX_aDbV_6-bKw/formResponse of Distance Le... Launch Meeting - Z.. 4 2020 HORNETS 4N... StudentVUE Clear s How is a protein made in the cell? * One strand of DNA in the ribosome combines with amino acids. Two strands of DNA in the nucleus combine with amino acids. One strand of RNA in the ribosome is the template (model) for an amino acid sequence. Two strands of RNA in the nucleus are the template (model) for an amino acid sequence. Use the chart to determine the correct amino acid that this DNA would code for - ATA EGFL Y. UCAGUCAG Gutame Aspart ac

General Instruction: Answer the following questions completely. 1. Construct a Venn Diagram to compare and contrast the structure and function of DNA and RNA. DNA RNA 2. The Continuity of life is based on heritable information in the form of DNA, and structure and function are correlated at all levels of biological organization. Describe how the structure of DNA is correlated with its role as the molecular basis of inheritance. (Answer must be in 3- 5 sentences only).

AKS 5c: Which student correctly explained what is occurring in the images? AEGCEE ECCUAE FACGAAAGCAEA 3' Met Leu Ser Tyr Tyr Gle Ser le Met Leu Ser Tyr Tyr Glu Ser le The 4th student explains the first arrow must demonstrate how the base pairing rule is being used to replicate a strand of DNA since the complementary pairs are being O lined up for semi conservative replication. The second arrow must demonstrate the process of transcription since the DNA is being read at the ribosomes and the monomers of protein are being connected. The 1st student explains the first arrow must demonstrate how the base pairing rule is being used to replicate a strand of DNA since the complementary pairs are being lined up for semi conservative replication. The second arrow must demonstrate the process of translation since the RNA is being read at the ribosomes and the monomers of protein are being connected. The 2nd student explains the first arrow must demonstrate how the base pairing rule

Page 1 of 3 ZOOM DNA Replication_Protein Synthesis_Mutation Assignment *Please type your answers. 1. DNA synthesis and protein synthesis are two processes that are necessary for the cell. Why are these two processes necessary for the cell? How are they connected to each other? wious 4+ 144

11:41 Thymine Adenine 3 end Practice Problems Write the complementary strand for A-C-C-T-G-A-C-T-G Write the complementary strand for C-G-G-G-C-A-T-T-A of rna SlidePlae Problems Visit DNA Deoxyribonucleic acid. DNA labeled complemen- structure DNA is a nucleic acid ... mplementary strand tary strand of dna C-G-G-G-C Images may be subject to copyright. Learn More TT-A dna replication Related images DNA Deoxyribonucleic acid. DNA . slideplayer.com What is the complementary strand Seeof DNA? > Practice Question •ATTCCG If the template of a strand of DNA is 5'AGATGCATC", the complementary strand 5CGGCATTA3 will be A TCTACGTAG B. CTACGTAGA C AGATGCATC D." AGACGTCTA ANSWER: TAAGGC A AA AQ A,T,C,G complementary stran

Assignment_12.pdf - Adobe Reader File Edit View Window Help Оpen 1 / 1 99,1% Tools Fill & Sign Comment 3. Recombinant protein is produced by a genetically engineered strain of Escherichia coli during cell growth. The recombinant protein can be considered a product of cell culture even though it is not secreted from the cells; it is synthesized in addition to normal E. coli biomass. Ammonia is used as the nitrogen source for aerobic respiration of glucose. The recombinant protein has an overall formula of CH1.5500.31N..25. The yield of biomass (excluding recombinant protein) from glucose is measured as o.48 g/g; the yield of recombinant protein from glucose is about 20% of that for cells. How much ammonia is required? What is the oxygen demand? If the biomass yield remains at 0.48 g /g, how much different are the ammonia and oxygen requirements for wild-type E. coli that is unable to synthesize recombinant protein? а. b. с. 24°C 08:39 Berawan 27/04/2022

8:42 ul 5Gº 0 Chapter 9 DNA worksheet 2022.d... CCG Pro CAG Gln ACU ThrAAU Asn ACC Thr AAC Asn ACA ThrAAA Lys CUG Leu AAUU Ile AUC Ile AUA Ile AUG Met START ACG ThrAAG Lys GGUU Val GUC Val GUA Val GUG Val G AGU Ser IC CGG Arg AGC Ser AGA Arg A AGG Arg GCU Ala GAU Asp GCC Ala GAC Asp GGC Gly GCA Ala GAA Glu GCG Ala GAG Glu GGG Gly GGU Gly C A U GGA Gly G 4. A set of DNA has been given that is 40% T bases. W percentages of the other bases in this sequence A,C, and 5. (2 points) A. What organelle is responsible for Translation? B. Where is the organelle from part A located in Euk 6. What are the three types of RNA and what are their fu during protein production? Dashboard Calendar To Do Notifications Inbox 因

Legrning Task 2: Make a.model of a DNA template to deternmine the seguence of bases in th new DNA strahds Then, answer the gulde questions that follow. Materials: crayons. Scissors, paste/tape, used folder or illustration board Procedure: Use the pattern of the DNA templater (attached to this LP). Color code, phosphate = blue, deoxyribose sugar = green, nitrogenous base as follows: adenine= yellow, thymine = pink, guanine = violet, cytosine = red. And cut the shapes of each nucleotides. Buld a model of a strand of a DNA molecule. The strand should contain 6 base" rungs" following the given order of the nucleotides: Guanine, Adenine, Cytosine, Thymine, Cytosine, Guanine. Tape the cutout pattern to form the nucieotides. This will represent the left half of DNA. Make a complementary strand that you made in step 3. Tape the cut -out pattern again forming the nucieotides for the second strand of the DNA molecules. Match the bases of the first strand and the second strand. Do not tape across…

7:25 7 copiea imto a new molecule of RNA. What happens during the TERMINATION step of transcription? A. base pairs are added to the mRNA transcript B. RNA polymerase starts creating the mRNA transcript C. RNA polymerase stops adding bases to the mRNA transcript, causing the mRNA to separate from the DNA Copyright © 2003 - 2022 International Academy of Science. All Rights Reserved. 7

mce ce.com/student/studentformative/ Online Tools Juan Bonilla Velasquez > Nimitz 20-21: CA Biology Prosyn Question 4 (6C) A section of a nucleic acid is shown below. Nontemplate strand Polymerase Ribonudeotide Template strand The process represented in the diagram produces a molecule that is complementary to the template strand of DNA. What type of molecule is produced? Answer new DNA G polypeptide H messenger RNA carbohydrates Question 4 Next + Previous ogies inc 2021 - Edugence Sign out

1B 3/23 DNA/Protein Synt x S le festin song analysis | Scho0 X G what compounds are respons mmon-assessment-delivery/start/4797160920?action3Donresume&submissionld%3D468979669 English 9 Student D.. A Type of Genetics Cr. S TEWWG Chapter 1. ppppppppppppppp. ONA Protein Synthesis Test DNA REPLICATION DNA Replication takes place during v and the end result is 5 67 8 9 10 11 Support Schoology Blog I PRIVACY POLICY